Latest Articles Include:
- Science scorned
- Nature (London) 467(7312):133 (2010)
Nature | Editorial Science scorned Journal name:NatureVolume: 467 ,Page:133Date published:(09 September 2010)DOI:doi:10.1038/467133aPublished online08 September 2010 The anti-science strain pervading the right wing in the United States is the last thing the country needs in a time of economic challenge. Subject terms: * Policy * Journals * Media Article tools * 日本語要約 * Print * Email * Download PDF * Download citation * Order reprints * Rights and permissions * Share/bookmark * Connotea * CiteULike * Facebook * Twitter * Delicious * Digg "The four corners of deceit: government, academia, science and media. Those institutions are now corrupt and exist by virtue of deceit. That's how they promulgate themselves; it is how they prosper." It is tempting to laugh off this and other rhetoric broadcast by Rush Limbaugh, a conservative US radio host, but Limbaugh and similar voices are no laughing matter. There is a growing anti-science streak on the American right that could have tangible societal and political impacts on many fronts — including regulation of environmental and other issues and stem-cell research. Take the surprise ousting last week of Lisa Murkowski, the incumbent Republican senator for Alaska, by political unknown Joe Miller in the Republican primary for the 2 November midterm congressional elections. Miller, who is backed by the conservative 'Tea Party movement', called his opponent's acknowledgement of the reality of global warming "exhibit 'A' for why she needs to go". "The country's future crucially depends on education, science and technology." The right-wing populism that is flourishing in the current climate of economic insecurity echoes many traditional conservative themes, such as opposition to taxes, regulation and immigration. But the Tea Party and its cheerleaders, who include Limbaugh, Fox News television host Glenn Beck and Sarah Palin (who famously decried fruitfly research as a waste of public money), are also tapping an age-old US political impulse — a suspicion of elites and expertise. Denialism over global warming has become a scientific cause célèbre within the movement. Limbaugh, for instance, who has told his listeners that "science has become a home for displaced socialists and communists", has called climate-change science "the biggest scam in the history of the world". The Tea Party's leanings encompass religious opposition to Darwinian evolution and to stem-cell and embryo research — which Beck has equated with eugenics. The movement is also averse to science-based regulation, which it sees as an excuse for intrusive government. Under the administration of George W. Bush, science in policy had already taken knocks from both neglect and ideology. Yet President Barack Obama's promise to "restore science to its rightful place" seems to have linked science to liberal politics, making it even more of a target of the right. US citizens face economic problems that are all too real, and the country's future crucially depends on education, science and technology as it faces increasing competition from China and other emerging science powers. Last month's recall of hundreds of millions of US eggs because of the risk of salmonella poisoning, and the Deepwater Horizon oil spill, are timely reminders of why the US government needs to serve the people better by developing and enforcing improved science-based regulations. Yet the public often buys into anti-science, anti-regulation agendas that are orchestrated by business interests and their sponsored think tanks and front groups. In the current poisoned political atmosphere, the defenders of science have few easy remedies. Reassuringly, polls continue to show that the overwhelming majority of the US public sees science as a force for good, and the anti-science rumblings may be ephemeral. As educators, scientists should redouble their efforts to promote rationalism, scholarship and critical thought among the young, and engage with both the media and politicians to help illuminate the pressing science-based issues of our time. Additional data - A destabilizing force
- Nature (London) 467(7312):133 (2010)
Nature | Editorial A destabilizing force Journal name:NatureVolume: 467 ,Page:133Date published:(09 September 2010)DOI:doi:10.1038/467133bPublished online08 September 2010 Public allegations threaten the impartiality of misconduct inquiries. Subject terms: * Medical research * Journals * Media * Internet Article tools * 日本語要約 * Print * Email * Download PDF * Download citation * Order reprints * Rights and permissions * Share/bookmark * Connotea * CiteULike * Facebook * Twitter * Delicious * Digg Investigations into charges of scientific misconduct are unpleasant for all concerned. Emotions run high and careers are jeopardized. As a consequence, it is crucial that all those involved, both directly and indirectly, behave with dignity and restraint. But events around such an investigation in Germany have taken a troubling and damaging turn from such good practice in the past few months. An unknown agitator using the presumed pseudonym Marco Berns is engaged in an e-mail and Internet offensive against two biomedical researchers whom he accuses of scientific fraud. Berns's libellous messages are targeted at dermatologist Ralf Paus and immunologist Silvia Bulfone-Paus, a married couple who both hold joint positions at the University of Manchester, UK, and the University of Lübeck, Germany. The trial-by-Internet is disturbing a formal investigation, organized by the Research Center Borstel in Germany and begun in July, into some of the pair's publications. Berns began sending e-mails to those involved in the inquiry shortly after it started, and has since widened his reach to researchers, politicians and journalists. He provides links to an untraceable website hosted in Panama, which contains more material. Those involved in the investigation are rightly appalled by the destabilization that these public accusations could cause. Claims of scientific misconduct must be assessed in confidence to protect both accused and whistle-blower from rumours that could prejudice the inquiry. But under the shadow of anonymity, it seems that little can be done to stop Berns. Upset and uncertainty will remain until the investigation is complete. Everyone involved must be presumed innocent until then, and the inquiry should report as quickly as possible without sacrificing fairness, impartiality and normal procedure. That is the best that can be done in this unfortunate affair. Additional data - Palaeontology: Leaf-like history of lacewings
- Nature (London) 467(7312):134 (2010)
- Astrophysics: The nuances of a fireball
- Nature (London) 467(7312):134 (2010)
- Marine ecology: Crab fights
- Nature (London) 467(7312):134 (2010)
- Networks: Contagious behaviour
- Nature (London) 467(7312):134 (2010)
- Astrophysics: How the galaxy lost its stars
- Nature (London) 467(7312):134 (2010)
- Primatology: Thanks mum!
- Nature (London) 467(7312):134 (2010)
- Atmospheric chemistry: A wandering ozone hole
- Nature (London) 467(7312):135 (2010)
- Evolutionary biology: Ginormous genomes
- Nature (London) 467(7312):135 (2010)
- Marine biology: Charismatic carbon
- Nature (London) 467(7312):135 (2010)
- Planetary science: Weighing the planets
- Nature (London) 467(7312):135 (2010)
- Journal club
- Nature (London) 467(7312):135 (2010)
- News briefing: 3–9 September 2010
- Nature (London) 467(7312):136 (2010)
The week in science. Download a PDF of this article. Policy|Business|Business watch|Research|People|Events|Awards|The week ahead|News maker|Sound bites Preliminary satellite data from Brazil's National Institute for Space Research in São José dos Campos indicate that the rate of deforestation in the country has dropped by 47.5%, from 4,375 square kilometres for August 2008–July 2009 to 2,296 square kilometres for August 2009–July 2010. At this rate, Brazil is set to meet its commitment to reduce deforestation by 80% by 2020 about a decade early. That corresponds to a reduction of roughly 1 billion tonnes of carbon dioxide emissions — equivalent to about 17% of annual US greenhouse-gas emissions. Nearly three weeks after Australia's national elections failed to produce a clear winner, the incumbent prime minister, Julia Gillard, said on 7 September that she had secured enough backing from other parliamentarians to form a minority government. Gillard's power-sharing negotiations have pushed climate change back up the political agenda: to win the support of the newly resurgent Green party, she had to sign up to a cross-party committee on climate change. The deal may increase support for setting a price on carbon emissions. A market-based carbon-trading scheme has been twice rejected by parliament and will not be reconsidered by Gillard until 2012; the Green party favours a straight tax. The proportion of oxygen-starved areas of US coastal waters has increased nearly 30-fold since 1960, finds the Interagency Working Group on Harmful Algal Blooms, Hypoxia, and Human Health. Incidents of hypoxia — in which oxygen levels are so low that fish and other animals die — were detected in almost half of the 647 waterways assessed, including the Gulf of Mexico. The report, published on 3 September, states that efforts to stop these dead zones occurring have "not made significant headway", and calls for the establishment of programmes to monitor and manage water quality in more areas. Germany's coalition government has agreed to extend the operating licences of the country's 17 nuclear reactors by an average of 12 years. The deal, struck late on 5 September, could also bring in €30 billion (US$39 billion) in taxes and levies from nuclear-power utilities, which would be invested in renewable-energy research and development before nuclear power is fully phased out during the 2030s. The previous government had intended to phase out the use of nuclear power by 2022. Plaintiffs behind a recent court injunction that has frozen US government funding for human embryonic stem-cell research have blasted a Department of Justice motion that would restore funding until the case goes to trial. The US government filed the appeal on 31 August, along with a request to stay the injunction. A bill that would enshrine the government's right to fund such research into law may be discussed as early as next week, when Congress reconvenes. See also page 138. Applications for Australian student visas have dropped by 11.5% in the 2009–10 academic year, according to the nation's Department of Immigration and Citizenship. The drop mirrors a decline in the total number of foreign students studying in Australia, which has fallen by roughly 16%, to about 270,000. The National Tertiary Education Union, the country's main union for academic staff, based in Melbourne, says that tightened immigration rules and campus attacks on foreign students have led to the declines. Pharmaceutical giant Pfizer, headquartered in New York, has agreed to buy FoldRx, a biotech company based in Cambridge, Massachusetts, for an undisclosed sum. FoldRx's lead drug candidate, tafamidis meglumine, is designed to treat transthyretin amyloid polyneuropathy, a rare inherited disease that leads to the build-up of misfolded protein deposits in nerves. The move comes less than three months after Pfizer set up a rare-disease research unit, also in Cambridge. Separately last week, Pfizer abandoned a deal made with Celldex Therapeutics based in Needham, Massachusetts, to fund the development a brain-cancer vaccine. SOURCE: NASDAQ The fraught romance between drug makers Sanofi–Aventis and Genzyme — a courtship that has had the world of biotechnology on the edge of its seat — came closer to turning hostile last week when Paris-based Sanofi ended a month of closed-door negotiations and on 29 August publicly announced its intention to buy Genzyme, of Cambridge, Massachusetts. The move was intended to appeal to Genzyme's shareholders, who have enjoyed a nearly 30% hike in the company's stock price since news of Sanofi's advances broke in late July. At that time, Genzyme's stock was hovering around US$54 a share, driven low by manufacturing problems that have restricted supplies of two of the company's top drugs and may not be corrected for up to four years. Sanofi has offered $69 a share, for a total of $18.5 billion: a premium that was rejected by Genzyme's board of directors on 30 August. The board called the proposal "opportunistic" and argued that the price failed to consider Genzyme's value once manufacturing woes have been addressed and further drugs come onto the market. But Christopher Viehbacher, head of Sanofi, said that Genzyme was "stonewalling", and that its management had "a history of over promising and under delivery". He has suggested that if negotiations continue to stall, Sanofi may attempt a hostile takeover. The European Space Agency's Gravity field and steady-state Ocean Circulation Experiment (GOCE), knocked out by a software glitch on 18 July, has resumed transmitting data to the ground. The satellite could become fully operational again as early as next week, according to Reiner Rummel, chair of the GOCE mission advisory group. The numbers of three endangered Asian vulture species — white-rumped (Gyps bengalensis), slender-billed (Gyps tenuirostris) and red-headed (Sarcogyps calvus) — are now either stable or on the increase in Cambodia, according to an annual census by the Cambodia Vulture Conservation Project. Elsewhere on the continent, many vulture populations have fallen by more than 95% since the mid-1990s owing to ingestion of toxic levels of diclofenac, a veterinary cattle drug present in their carcasses. But the drug is rarely used in Cambodia. See go.nature.com/pQLQaI for more. A physics advisory committee has recommended that the Tevatron, a particle accelerator at the Fermi National Accelerator Laboratory in Batavia, Illinois, should continue operating until 2014 at a cost of around US$150 million, rather than cease operation in 2011 as planned. An extended run would give the Tevatron a chance to find evidence of the elusive Higgs boson, according to the committee's report. See go.nature.com/YGL4Tr for more. P. NASKRECKI More than 20% of species in African lakes and watercourses are under threat of extinction, according to a recent assessment of 5,167 plants and animals by the International Union for Conservation of Nature (IUCN). Farming, deforestation, water extraction and dam building are driving habitat loss. Pollution and invasive species are also a problem. Many of the threatened animals, such as the Common Creek Crab (Liberonautes latidactylus; pictured), are overfished. The five-year study was prompted by the paucity of information on the conservation status of freshwater species in Africa, but the IUCN says that there are still gaps in surveying, particularly in northern and western Africa. After a decade running the Journal of the American Medical Association (JAMA), Catherine DeAngelis will step down as editor-in-chief in June 2011. She will head to Johns Hopkins University in Baltimore, Maryland, to establish a centre for professional medical ethics. During her tenure, JAMA adopted a tough stance on publication of pharmaceutical industry-funded research, prohibiting ghostwriting and requiring the clinical trials it publishes to be publicly registered. The journal has also called for independent statistical analysis of pharma-sponsored research. A magnitude-7.0 earthquake hit New Zealand's South Island on 3 September, causing widespread damage to Christchurch, the country's second largest city. There have been no reports of fatalities. The tremor's epicentre was about 50 kilometres west of Christchurch, and about 90 kilometres from two active faults, the Alpine fault and the Hope fault. Shinya Yamanaka of the Institute for Integrated Cell-Material Sciences in Kyoto, Japan, has claimed one of this year's Balzan Prizes for his work reprogramming adult cells to show the characteristics of embryonic stem cells. He will receive one million Swiss francs (US$989,000), half of which must go to research projects. The other science prize went to Jacob Palis of the Institute of Pure and Applied Mathematics in Rio de Janeiro, Brazil, for his work on dynamical systems. Two powerhouses of medical research, the Cold Spring Harbor Laboratory and the Wellcome Trust, are hosting their fourth conference on Infectious Disease Genomics and Global Health, which takes place in Hinxton, UK. → go.nature.com/jzJtuJ The World Energy Congress in Montreal, Canada, discusses how to meet the world's future energy demands. → wecmontreal2010.ca Agadir, Morocco, hosts the 3rd International Conference on Advanced Nano Materials, which includes sessions on biomaterials and energy. → http://anm2010.nanoac.org The controversial epidemiologist's appointment has not been renewed by the University of California, Los Angeles. His work questions the link between soot particles and deaths in California — findings he says are being ignored by regulators. US interior secretary Ken Salazar allays fears of another big spill after a fire on an oil and natural-gas production platform in the Gulf of Mexico on 2 September. Source: Los Angeles Times Greenspace blog; go.nature.com/d7MFH1 There are currently no comments. This is a public forum. Please keep to our Community Guidelines. You can be controversial, but please don't get personal or offensive and do keep it brief. Remember our threads are for feedback and discussion - not for publishing papers, press releases or advertisements. - US stem-cell chaos felt abroad
- Nature (London) 467(7312):138 (2010)
Court ruling endangers international partnerships. "If the ruling stands, our collaboration is severely curtailed," wrote Benoit Bruneau in an e-mail to a UK-based colleague last week. Bruneau is a developmental biologist at the Gladstone Institute of Cardiovascular Disease at the University of California, San Francisco, whose work relies on funds from the US National Institutes of Health (NIH). He had only recently established a partnership with Roger Pedersen, a human embryonic stem-cell scientist at the University of Cambridge, UK, to study a particular family of genes that has a prominent role in the development of cardiomyocytes — the specialized cells of heart muscle. Their enthusiasm for the project was running high because mutations in the genes have been implicated in congenital heart defects, heart arrhythmias and heart failure. Roger Pedersen left California to work on human embryonic stem cells and may now lose a US collaborator. Bruneau was planning to dip into a large consortium grant from the NIH to fund his part of the planned work. Pedersen would provide him with human embryonic stem cells fluorescently tagged and genetically modified to carry the disease-causing mutations. Bruneau would then analyse how the relevant genes were acting as the cells developed into fully formed heart cells. But an injunction on 23 August by US district judge Royce Lamberth temporarily blocking federal funds allocated for human embryonic stem-cell research has thrown the collaboration's survival into question. If the suspension becomes permanent policy, and the project dies, "it will be a huge missed opportunity", says Bruneau. "Because Benoit is the world's expert on this gene family, it may impede our ability in the United Kingdom to get funding for this project, to achieve the project's goals and to bring it to the clinic," adds Pedersen. Pedersen's concerns point to the global repercussions of Lamberth's decision. Overseas collaborations are threatened, foreign postdocs face the prospect of a sudden end to the projects that brought them to the United States, and confidence abroad has been shaken. Although the government is appealing Lamberth's ruling, the likelihood of a future court battle and legislative jousting means that, at the very least, months of uncertainty will hang over the field (see 'Stem-cell bill may need fixing'). "The fact that [US] policy can change every four years or less is a huge deterrent to [human embryonic stem-cell] researchers and to the progression of research," says Pederson. "That's the hurricane. That's what's doing the damage." Andrew Elefanty, a stem-cell scientist at Monash University in Melbourne, Australia, says that if the US situation is not speedily resolved it will affect his work. Elefanty is an expert in producing stem-cell lines labelled with fluorescent 'reporter' genes, which are useful for identifying specific cell types as they differentiate in vitro. Since 2008, 13 of the 21 international research collaborations that Elefanty and his lab co-chief Ed Stanley have established or are in the process of establishing are with groups in the United States. "Our concern is that uncertainty in the United States will limit our ability to collaborate, which then has knock-on effects on the quality of work we can put out. We depend on a lot of those collaborators to do really good science," says Elefanty. The funding freeze may affect some foreign scientists directly; they are eligible to win NIH grants if no American is doing the same work. Andrew Laslett, a stem-cell scientist at the Commonwealth Scientific and Industrial Research Organisation in Melbourne, was paid as a postdoc for three years from a large, collaborative NIH grant to derive kidney progenitor cells from human embryonic stem cells. "That grant really set me on my career. It introduced me to the people I am still collaborating with today, and led me to getting my first independent grant," says Laslett. The news of some of those collaborators in the United States now losing funding "made me cringe", he adds. A further layer of uncertainty hangs over foreign postdocs working in the United States who must now consider whether to remain in the country. "It's kind of all sinking in at the moment," says Adam Goulburn, who earned his PhD in Elefanty's lab and started a postdoc at Weill Cornell Medical College in New York last month. Working in the lab of Stewart Anderson, Goulburn is trying to derive pure populations of interneurons from human embryonic stem cells. The improper migration and function of these cells in the developing brain has been implicated in diseases including autism, epilepsy and schizophrenia. Goulburn's project is not immediately threatened, but the private seed money supporting him today will ultimately require scaling up with NIH funds. Anderson says that if the injunction stands, his ability to fund Goulburn's project in the long run will probably be impaired. In the future, "highly talented, well-trained stem-cell researchers from abroad, like Adam, will likely seek further training in other countries", says Anderson. "The work and growth will continue," he says, "just not in the United States." ADVERTISEMENT Some foreign postdocs in the United States are committed to staying the course. Dennis Van Hoof, a Dutch postdoc at the Diabetes Center at the University of California, San Francisco, is supported by private and state grants. A type 1 diabetic himself, Van Hoof says that the injunction has not changed his plans; he was drawn to the United States by the chance to work on human embryonic stem-cell applications to his disease — an opportunity that was lacking in the Netherlands. Yet, he concedes, the prospect of federal funding for his work now looks "very insecure". Pedersen says he is sad for colleagues working in the United States: he decamped from the University of California to Cambridge in 2001, after George W. Bush was elected and Pedersen's application for a grant for human embryonic stem-cell work — the first such application to the NIH — was summarily shelved. Looking back, "I don't feel vindicated", says Pedersen. "I feel aggrieved. It's my country and I think it's harmed by this." This is a public forum. Please keep to our Community Guidelines. You can be controversial, but please don't get personal or offensive and do keep it brief. Remember our threads are for feedback and discussion - not for publishing papers, press releases or advertisements. - NASA panel weighs asteroid danger
- Nature (London) 467(7312):140 (2010)
Telescopes in space could help pin down the risk of a deadly impact. Some time in the next decade, a US president will probably be presented with this dilemma: is it worth spending US$1 billion to deflect a space rock that may never hit Earth? A NASA panel is wrestling with this question, which is growing more pertinent as scientists' ability to find asteroids that pose a potential risk, termed near-Earth objects (NEOs), outstrips their capacity to track them accurately. The Ad-Hoc Task Force on Planetary Defense, set up to suggest ways for the agency to protect Earth against a deadly impact, is expected to release its report next month. But public deliberations and interviews with its members have revealed their thinking. The dilemma stems from a 2005 congressional mandate directing NASA to log 90% of the estimated 20,000 NEOs larger than 140 metres in diameter by 2020. NASA seems unlikely to meet the goal, but the agency is stepping up its detection and tracking of smaller objects. "Missions to deflect all potential threats will be prohibitively expensive." That will create a new problem: if the pace of NEO detections (see graph) grows but precision tracking of orbits lags behind, observers will start to find more rocks — perhaps a few per year — that seem, at first, to have a significant chance of hitting Earth, say panel members. "I don't think that issue has been understood outside the NEO community," says Lindley Johnson, NEO programme officer at NASA and a member of the panel. Launching missions to track or deflect all potential asteroid threats will be prohibitively expensive, but even a small probability of regional or global devastation may not be politically palatable. Click for a larger version.SOURCE: A. CHAMBERLIN/JET PROPULSION LAB.; DEFENDING PLANET EARTH/NATIONAL RESEARCH COUNCIL One solution from the panel is to increase the amount that the United States invests in NEO detection and tracking from the current $5.5 million a year. The panel may also recommend the launch of a survey telescope into a solar orbit similar to that of Venus. It would orbit faster than Earth and, looking outwards, would see asteroids in Earth-crossing orbits more often than would ground-based instruments (see diagram). This could improve follow-up observations, narrow estimated trajectories and remove as many asteroids as possible from the threat list. It could also spot and track asteroids on the sunward side of Earth, removing a worrisome blind spot in ground-based surveys. "It is a wonderful rapid technique to track bodies down to 140 metres and smaller," says Tom Jones, a former astronaut and panel co-chair. Ball Aerospace and Technologies Corporation, a manufacturer of spacecraft based in Boulder, Colorado, has proposed building such a remote scope at a cost of $600 million. But Irwin Shapiro, an astrophysicist at the Harvard–Smithsonian Center for Astrophysics in Cambridge, Massachusetts, who chaired the 2010 Committee to Review Near-Earth-Object Surveys and Hazard Mitigation Strategies for the US National Research Council, says that ground-based observatories such as the planned Large Synoptic Survey Telescope (LSST) on Cerro Pachón in Chile are better value for money than space telescopes, because they last longer and are less expensive. He says the LSST is also more likely to command funding, as it is the top priority recommended by the Astronomy and Astrophysics Decadal Survey, released in August by the National Academies. Putting a space telescope in a Venus-like orbit "would in effect start from scratch", he says. Owing to a 2008 law passed by Congress, the White House Office of Science and Technology Policy has until 15 October to decide which agency will be responsible for protecting the planet from an asteroid strike. Members of the task force say NASA expects to be given part or all of that responsibility. To meet it, the panel discussed the creation of a Planetary Protection Coordination Office (PPCO) within NASA, with an annual budget of $250 million–$300 million. It would detect and track asteroids — and develop a capability to deflect them. "You want to use a proven capability when you're talking about an actual threat," says Rusty Schweickart, a former astronaut and the other panel co-chair. ADVERTISEMENT The PPCO would also challenge other countries to fund defence against asteroids, perhaps through the United Nations. Canada already plans to launch the NEO Survey Satellite in 2011, and Germany's AsteroidFinder is slated for launch in 2012, but neither is expected to come close to the NEO-logging goal by 2020. Shapiro stresses that it is unclear whether Congress will give further funds to planetary protection, noting that if it doesn't, there is a risk of the money being taken away from space science. Yet without better detection and tracking there will inevitably be uncertainty about asteroid positions in the future — and even greater expense if the uncertainty leads to unnecessary efforts to thwart an apparent pressing threat. There are currently no comments. This is a public forum. Please keep to our Community Guidelines. You can be controversial, but please don't get personal or offensive and do keep it brief. Remember our threads are for feedback and discussion - not for publishing papers, press releases or advertisements. - Rare victory in fight against melanoma
- Nature (London) 467(7312):140 (2010)
Genetically tailored approach could slow disease progress. Melanoma tumours shrank after patients took PLX4032 for 2 weeks.REF. 2 Patients with advanced melanoma rarely live for more than a year after their diagnosis — a prognosis that has not improved for more than 30 years. But clinical-trial results1 now suggest that a genetically targeted approach could slow the disease's steady march through the body, and separate research2 reveals why the latest drug being tested may succeed where others failed. The drug could be the first melanoma treatment to join an elite but expanding list of cancer therapies tailored to a patient's genetic make-up (see 'Seek and destroy'). "It's spectacular," says Richard Marais, a molecular biologist at the Institute of Cancer Research in London, who was not affiliated with either study. "There's been a paradigm shift in how you would treat melanoma." In 2002, Marais and his colleagues reported3 that more than 60% of patients with melanoma — cancer of the melanin-producing cells typically found in skin — carry mutations in a gene that encodes a protein called B-RAF. The mutations trigger a signalling pathway that accelerates cancerous cell growth. Drug companies pricked up their ears at the discovery. One of them, a small biotechnology company in Berkeley, California, called Plexxikon, started fishing for compounds that would selectively block mutated B-RAF by filling the unique pocket that the genetic mutation etches into the protein's three-dimensional structure. At first, the approach was greeted with scepticism, says Plexxikon's chief executive Peter Hirth. Decades of failure had taught drug companies to shy away from testing drugs against advanced melanoma. "People don't want to do clinical trials in melanoma," agrees Marais. "It's sort of the death knell for all cancer therapies." Early tests of Plexxikon's drug, called PLX4032, were disappointing. Some patients in the trial were taking dozens of pills a day, to no effect. "But we just couldn't give the patients any more pills," says Paul Chapman, a cancer researcher at the Memorial Sloan-Kettering Cancer Center in New York and a co-author on the latest clinical trial1. "We were starting to think we were going to obstruct their gut with all the cellulose from the capsules." So Plexxikon, together with its partner, Swiss drug maker Roche, developed a new formulation of the drug that was more easily absorbed by the body. That reformulation proved crucial. On 26 August, researchers published the first findings from a small clinical trial of the reformulated drug. In one arm of the study1, tumours shrank by at least 30% in 24 out of 32 patients with B-RAF mutations, and disappeared entirely in two other patients. This week in Nature2, the Plexxikon team reveals why the high doses were necessary: analysis of tumour samples from patients who received different amounts of the drug showed that PLX4032 was effective only at concentrations sufficient to block about 80% of signalling through the B-RAF pathway. This roughly matches early clinical-trial results of a similar drug being developed by London-based GlaxoSmithKline (GSK), says Jeffrey Legos, the company's medicines development leader. The Plexxikon team also found that PLX4032 was remarkably specific for the mutated form of B-RAF, binding relatively poorly, if at all, to more than 200 other proteins, including unmutated B-RAF. That selectivity, says Hirth, probably explains why patients were able to take PLX4032 at such high doses without severe side effects. Despite the promising results, PLX4032 has been tested in only a small number of patients and it is too early to declare the drug a success, cautions Chapman. The next stage is a larger trial in 700 patients, which began in January. And although PLX4032 has clear short-term effects on tumour growth, researchers don't yet know whether the drug will allow patients to live significantly longer. Melanoma tumours quickly become resistant to PLX4032, and researchers estimate that tumour growth typically resurges about seven months after the start of therapy. "These cancer cells are smart," says Legos. "You shut down one specific pathway, and they will find a different way to survive." Nevertheless, Legos notes that, given the short survival of patients with advanced melanoma, it seems likely that drugs such as PLX4032 will have some effect on lifespan. ADVERTISEMENT To overcome resistance, PLX4032 will be tested in combination with other drugs. In addition to the larger trial of PLX4032 alone, Plexxikon is planning a trial that will combine PLX4032 with an experimental drug that blocks MEK, another protein involved in the cell-growth-promoting pathway. Meanwhile, GSK is recruiting patients for a clinical trial combining two of its own experimental drugs, which respectively block mutated B-RAF and MEK. For now, the promising results from PLX4032 highlight the power of targeting specific genetic mutations in tumours, says Yardena Samuels, a cancer geneticist at the National Human Genome Research Institute in Bethesda, Maryland. "It's a very important development, not just for melanoma, but for the entire cancer field." * References * Flaherty, K. T. et al. N. Engl. J. Med.363, 809-819 (2010). | Article | ChemPort | * Bollag, G. et al. Naturedoi:10.1038/nature09454 (2010). * Davies, H. et al. Nature417, 949-954 (2002). | Article | PubMed | ISI | ChemPort | This is a public forum. Please keep to our Community Guidelines. You can be controversial, but please don't get personal or offensive and do keep it brief. Remember our threads are for feedback and discussion - not for publishing papers, press releases or advertisements. - Teams battle for neuron prize
- Nature (London) 467(7312):143 (2010)
Contest spurs progress for programs that can map a brain cell's myriad branches. Flanked by his graduate students, Badrinath Roysam, a computer scientist from the Rensselaer Polytechnic Institute in Troy, New York, stared tight-lipped at a large computer screen covered in strange white cobwebs and thin lines. A judge sat upright in a chair, pointing out gaps and mistakes in the data on the screen. A timekeeper tapped at an electronic stopwatch. Badrinath Roysam (centre, standing) and his team developed an algorithm to construct a map of a neuron (below) from many individual microscope images.J. KEGLEY B. ROYSAM, RPI Down the hall at the Janelia Farm Research Campus in Ashburn, Virginia, part of the Howard Hughes Medical Institute, four other teams were also being judged under the watchful eyes of timekeepers. They were taking part in the final round of the Digital Reconstruction of Axonal and Dendritic Morphology (DIADEM) Challenge, which ran from 29 August to 1 September. The contest aimed to promote the development of computer algorithms that can successfully chart a neuron's many twists and branches; a time-consuming task that has plagued neurobiologists for decades. In the process, it has pioneered a novel way to advance biomedical innovation — through competitions and prizes. Neuron shape is intimately related to function, and mapping it is key to tracing the myriad connections that make up a working nervous system. For biologists, tracing each forking axon and dendrite is straightforward but slow, requiring researchers to painstakingly work their way through stacks of microscope images. It can take six months to map the hundreds or thousands of branches in a single rat cortex neuron by eye — the entire cortex could take millions of years. Computer scientists, by contrast, say that their algorithms should make quick work of the problem — except that the programs can only cope with images that are simple enough for a computer to interpret. "In creating this challenge, I imagined these two groups sparring around a chessboard," says the competition's organizer, Giorgio Ascoli, a neuroscientist at George Mason University in Fairfax, Virginia. He says that the contest's objective was to force the two sides to engage, pushing biologists to make their data more computer friendly, and making algorithms robust enough to contend with real-world information. The DIADEM challenge asked teams of computer scientists to find an algorithm that could accurately map a single neuron's branches at least 20 times faster than a human. Ascoli says that the sets of images thrown at the competing algorithms were intended to be suitably tough and were drawn from many different organisms, brain regions, cell types and staining techniques. The neurologists who provided the data also acted as judges. For added impetus, a US$75,000 prize was offered. Yet the challenge proved more difficult than expected. Five of the 125 teams that entered algorithms in the competition made it to last week's finals, but none achieved the benchmark of a 20-fold improvement in speed. In the end, the judges decided to divide the prize money between four of the teams — including Roysam's — based on which algorithms showed the most promise. Despite having no clear winner, the tournament ended with plenty of positive momentum, says Ascoli. Minutes after the prizes were announced, contestants proposed the formation of a consortium to advance the technology. "I thought this would be in the future, but this event made it start to happen now," says Ascoli. The DIADEM challenge also spurred innovation for a fraction of its normal cost. Conventional grants and funding opportunities for this type of research would run between $36 million and $120 million, says Story Landis, director of the National Institute of Neurological Disorders and Stroke in Bethesda, Maryland, part of the National Institutes of Health (NIH). ADVERTISEMENT The US Defense Advanced Research Projects Agency has often used prizes to encourage innovation. In upcoming legislation, the National Science Foundation (NSF) is also likely to be granted this authority from Congress — a necessary step because it represents a variation from the NSF mandate to use peer review to guide fund allocation. Inspired by DIADEM, the NIH now hopes to receive authority to set up competitions of its own, says Landis, although she added that it was premature to say what kinds of problem the NIH might select as challenges. When the results from the DIADEM competition are published in an upcoming special issue of Neuroinformatics, other researchers may in turn be inspired to join the mapping effort, says Ascoli. Given that the competition's data owners and algorithm developers are already brainstorming how to integrate their results into one research effort, he is hopeful that the technical barrier between them will soon fall. "Once the first brick comes down," he says, "the whole wall follows." There are currently no comments. This is a public forum. Please keep to our Community Guidelines. You can be controversial, but please don't get personal or offensive and do keep it brief. Remember our threads are for feedback and discussion - not for publishing papers, press releases or advertisements. - Big emitters team up
- Nature (London) 467(7312):144 (2010)
US–China clean-energy collaboration targets coal and cars. China and the United States have taken a small but significant step together towards reducing their energy consumption and greenhouse-gas emissions. On 2 September, US energy secretary Steven Chu announced the first projects of a bilateral programme, the US–China Clean Energy Research Center (CERC). Those involved admit that its US$150-million budget is a tiny fraction of what will be needed to address both nations' growing energy demands, but say that it is important both as a symbolic effort, and because it paves the way for future collaboration. CERC will have headquarters in each country and aims to develop and commercialize new technologies through public–private consortia. The first projects include a clean-vehicles collaboration, led by the University of Michigan in Ann Arbor, and involving major vehicle manufacturers; and a 'clean carbon' project led by West Virginia University in Morgantown, which will include efforts to trap emissions from coal-fired power stations using carbon capture and storage (CCS) systems. "Both countries rely heavily on coal resources," says Jerald Fletcher, director of the Natural Resource Analysis Center at West Virginia University and leader of the clean-carbon collaboration. "It is imperative that the United States and China, the two largest energy users and greenhouse-gas emitters, work together to address these issues." A US consortium in clean buildings will be announced this autumn, and China is expected to announce parallel consortia in the same three fields soon. Each of the six consortia will receive $12.5 million from the respective governments, to be matched by consortium members. Dennis Assanis, director of the Michigan Memorial Phoenix Energy Institute and leader of the clean-vehicle project, says the two countries bring complementary skills. "Universities in the United States are known for high-calibre research and for demonstrating technology in the laboratory. Universities in China are strong at demonstrating technologies in full-vehicle prototypes," he says. "Because the United States and China are the biggest producers of vehicles globally, solutions we develop to make transportation more environmentally friendly will make the biggest contribution to the environment." "For the past decade, China has been saying, 'we want to do more joint research, we want you to come in and pay half'," says Deborah Seligsohn, a Beijing-based analyst for the World Resources Institute. "Someone finally took them up on it." On the US side, planners hope that the projects will give a boost to green industries. According to Who's Winning the Clean Energy Race?, a March report from the Pew Charitable Trusts — non-profit policy analysts in Washington DC — China became the biggest investor in clean energy in 2009 (see Table 1). Most of this money was spent on wind- and solar-power infrastructure; China already leads the world in manufacturing these components (see Nature 457, 372–374; 2009). Many other countries are now hoping to forge links with China's booming clean-energy industry. Australia, for example, has allocated Aus$20 million (US$18 million) for collaboration on CCS; the United Kingdom has put £11.49 million (US$17.7 million) into 14 ongoing projects on renewable-energy technologies and cleaner fossil fuels, and will announce further joint efforts on CCS, solar power and fuel cells in the coming months. ADVERTISEMENT There are still many wrinkles to be ironed out with CERC. In contrast to the US open bidding system, the Chinese government is appointing its consortia, raising concerns among US partners about who they might be working with. And Ann Marie Sastry, a materials scientist and part of the University of Michigan's clean-vehicle consortium, says that as both nations compete for technology markets, there are likely to be tensions about the intellectual property generated by CERC. "It's going to be awkward in the beginning," agrees Sabina Brady, executive director at the US–China Energy Cooperation Program, a business association representing 35 US companies in China, many of which are involved in the consortia. "CERC could be improved. But the important part of CERC is that it got started." This is a public forum. Please keep to our Community Guidelines. You can be controversial, but please don't get personal or offensive and do keep it brief. Remember our threads are for feedback and discussion - not for publishing papers, press releases or advertisements. - 'Climate wars' claims disputed
- Nature (London) 467(7312):145 (2010)
New research challenges idea that global warming will drive civil unrest. The idea that climate change might be a trigger for social disorder, population migration and conflict has an impressive pedigree. The link was mooted in a 2003 report for the Pentagon on the national-security implications of climate change; by the Stern review on the economics of climate change, prepared for the UK government in 2006; and in the United Nations' post-conflict environmental assessment of Sudan in 2007, which suggested that climate change was an aggravating factor in the Darfur conflict. But is there real proof of a link between climate change and civil war? No, says Halvard Buhaug, a political scientist with the Peace Research Institute Oslo. In research published this week1, he finds almost no correlation between climate-change indicators, such as temperature and rainfall variability, and the frequency of civil wars over the past 50 years in sub-Saharan Africa — arguably the part of the world that is socially and environmentally most vulnerable to climate change. "The primary causes of civil war are political, not environmental," says Buhaug. The analysis challenges a study published last year by Marshall Burke, an economist at the University of California, Berkeley, and colleagues, who reported a strong historical relationship between temperature and the incidence of civil war2. They found that the likelihood of armed conflict across the continent rose by some 50% in unusually warm years between 1981 and 2002. Neither Burke nor Buhaug is giving any ground; each challenges the other's definition of 'civil war' and choice of climate data sets. ADVERTISEMENT Given the many causes of unrest, it is not surprising that a meaningful correlation with climate is hard to pin down, says Hans Joachim Schellnhuber, director of the Potsdam Institute for Climate Impact Research in Germany. "This does not at all diminish the importance of responding to climate change," adds Roger Pielke, a climate policy expert at the University of Colorado in Boulder. "But it does offer a stark warning about trying to use overly simplistic notions of cause and effect to advocate for such actions." * References * Buhaug, H.Proc. Natl Acad. Sci. USAdoi:10.1073/pnas.1005739107 (2010). * Burke, M. B.et al. Proc. Natl Acad. Sci. USA106, 20670-20674 (2009). There are currently no comments. This is a public forum. Please keep to our Community Guidelines. You can be controversial, but please don't get personal or offensive and do keep it brief. Remember our threads are for feedback and discussion - not for publishing papers, press releases or advertisements. - Correction
- Nature (London) 467(7312):145 (2010)
The article 'Ecologists fear Antarctic krill crisis' (Nature 467, 15; 2010) incorrectly stated that North Korean ship owners are resistant to the idea of granting scientists access to commercial fishing vessels. It should have said 'South Korean'. There are currently no comments. This is a public forum. Please keep to our Community Guidelines. You can be controversial, but please don't get personal or offensive and do keep it brief. Remember our threads are for feedback and discussion - not for publishing papers, press releases or advertisements. - Neuroscience: In their nurture
- Nature (London) 467(7312):146 (2010)
Can epigenetics underlie the enduring effects of a mother's love? Lizzie Buchen investigates the criticisms of a landmark study and the controversial field to which it gave birth. Download a PDF of this story. After dropping a pair of male and female adult rats into a rectangular Plexiglas container, Frances Champagne can expect one of a few scenarios to ensue. The male will definitely try to mate with the female — but the female is less predictable. She might approach him, appraise his scents and arch her back to allow him to mount her. Should a second male enter the cage after she's mated with the first, she may be similarly hospitable. Some females play it coy, however, evading the male, requiring more courtship and, if mating does occur, avoiding another go. A number of factors can influence what the female does, but to Champagne, a behavioural scientist at Columbia University in New York, one is particularly beguiling: how often the female rat's mother licked and groomed her during her first week of life1. Doting mothers have prudish daughters, whereas the daughters of inattentive rats cavort around like mini Mae Wests. At the heart of these differences lies the sex hormone oestrogen, which drives female sexual behaviour. Champagne says that neglected rats might respond to it more strongly than those raised by attentive mums. The phenomenon is just one example of how experiences early in life can shape behaviour, and it may apply to humans. It is known, for example, that children who grow up in poverty are at greater risk as adults for problems such as drug addiction and depression than those with more comfortable upbringings, regardless of their socioeconomic situation later in life. But what is it about early experiences that has such a lasting effect? For Champagne and many of her colleagues, the answer has been apparent for nearly a decade. Life experiences alter DNA; not necessarily its sequence but rather its form and structure, including the chemicals that decorate it and how tightly it winds and packs around proteins inside the cell. These changes, often referred to as epigenetic modifications, make genes easier or more difficult for the cell's protein-making machinery to read (see 'The marking of a genome'). Click for a larger version. The most enduring epigenetic change is thought to be the attachment of methyl groups to specific nucleotides in DNA, which can completely silence the expression of nearby genes. Champagne says that her neglected rats might have less methylation near the oestrogen receptor gene. And such differences occur specifically in regions of the hypothalamus known to be involved in sexual behaviour. Less methylation leads to increased expression of the oestrogen receptor throughout life, she reasons, making the adult daughters more responsive to the hormone's influence when sizing up suitors. The idea that epigenetics could explain the lasting effects of something as short-lived but profound as a mother's affection has breathed life into the behavioural sciences, providing a molecular middle ground in the centuries-old debate over nature versus nurture. Epigenetic changes could be the conduit through which environment elicits life-long biological change. Many behavioural scientists have latched onto the idea, searching for epigenetic explanations for a number of differences in behaviour, including homosexuality, intelligence and conditions such as autism and schizophrenia. Although experience has been connected to altered methylation for only a handful of genes, epigenetics has become one of the hottest areas of behavioural science. But it is also one of the most hotly contested. A struggle for acceptance Behavioural epigeneticists have run up against deep resistance to their ideas — generally from molecular biologists and biochemists, who have been studying DNA methylation since the 1960s. When methyl groups coat DNA early in embryonic development, the affected genes are turned off for the life of the animal; for example, this mechanism permanently shuts down one of the two X chromosomes in female mammalian cells. Many find the idea that DNA methylation could be influenced by maternal care hard to swallow. Behavioural epigenetics "is a field that has a lot of deep problems", says Timothy Bestor, a geneticist also at Columbia University who studies DNA methylation in sex cells. The evidence supporting it is weak and grossly over-interpreted, according to Bestor and other critics, and the mechanism by which it works remains unclear. To prove the field's worth to the hard-core molecular biologists, the behaviourists will have their work cut out for them. The debate has been raging since the early 2000s, when Champagne was in graduate school at McGill University in Montreal, Canada. Her adviser, Michael Meaney, a behavioural scientist, was trying to explain why rats raised by attentive mothers were, as adults, able to deal with stress better than rats raised by more negligent mothers. Meaney's group found that levels of the glucocorticoid receptor, a protein that regulates the reaction to stress hormones, were different in these two groups, but the group puzzled over how the difference came about. Serendipitously, Meaney met Moshe Szyf, a molecular biologist at McGill who was studying DNA methylation in cancer. His research had shown that DNA methylation might act as an on–off switch for cancer-causing genes2. As the two discussed Meaney's stressed-out rats, they wondered whether the same mechanism might be at play. They collaborated, and found different methylation patterns between groomed and ungroomed pups. Their work su! ggested that a mother rat's preening could remove methyl groups from her pups' DNA. This alteration, they argued, made the gene for the glucocorticoid receptor more accessible to protein-making machinery. Szyf was excited, but surprised. DNA methylation was thought to be stable. For this reason, says Szyf, the paper struggled through the review process, and was rejected by both Nature and Science. "The main review was, 'We never heard that DNA methylation changes after birth'," he says. "Something that doesn't fit with their dogma has to be wrong." After two-and-a-half years, the paper found an outlet in Nature Neuroscience3 in 2004. And among behavioural neuroscience researchers, Meaney says, it caused a stir. "They understood immediately that epigenetic mechanisms were a great candidate that could explain the enduring effects of the early environment," he says. A deluge of research projects ensued, and are beginning to bear fruit. In December, Dietmar Spengler at the Max Planck Institute of Psychiatry in Munich, Germany, and his colleagues showed that separating mouse pups from their mothers for short periods of time reduced the methylation near the arginine vasopressin gene, possibly leading to a depression-like condition4. In May, David Sweatt at the University of Alabama at Birmingham showed that stress in early life changed the methylation status of the rat Bdnf genes, which encodes a growth factor involved in brain development and plasticity5. The work is starting to extend to humans as well. In 2009, Meaney and his collaborators compared the brains of people who had committed suicide and who were severely abused as children with those who were not. His data suggested that those who had been subject to abuse showed methylation changes in stress-related genes similar to those found in rats raised by inattentive mothers6. That same year, epigeneticist Jessica Connelly at Duke University in Durham, North Carolina, and her colleagues found methylation differences in the gene encoding the receptor for oxytocin — a hormone believed to influence social behaviour — in people with autism7. Now at the University of Virginia in Charlottesville, Connelly is pursuing this link further in humans and in prairie voles, which form close social bonds, so can potentially be used to help study human social behaviour. And Champagne, who started her own lab in 2006, is teaming up with researchers at the Columbia Center for Children! 's Environmental Health to see if pollution in northern Harlem and the South Bronx in New York is leading to epigenetic changes in children, making them more prone to conditions such as asthma and obesity. Meany's 2004 study3 eventually became one of Nature Neuroscience 's most cited papers. But the criticisms have not stopped. Molecular biologists' main problem with the behavioural neuroscientists' data is that they are highly correlative, and the underlying mechanisms are still largely unknown. Scientists who cut their teeth on in vitro systems — with their exacting control of variables and unambiguous data — cannot wrap their heads around messy data and tenuous links. "What's really important to understand is the enormous gap in mechanistic knowledge between people who work in simple systems, such as epigenetic inheritance in yeast, where people have spent years to go over mechanistic details and really understand how it works, to someone who looks at the enormous complexity of the brain," says Catherine Dulac, a molecular biologist at Harvard University in Cambridge, Massachusetts. The mechanics of upbringing One of the biggest bones of contention with the work of Meaney and Champagne is that there is no proven mechanism for actively removing methyl groups from DNA. A number of groups have proposed and published evidence of a 'demethylase' that would do this. Szyf's group, for example, published results in 1999 showing that a protein called MBD2 could rapidly remove methyl groups from DNA8. But critics argue that these have not stood the test of reproducibility. Adrian Bird, who studies DNA methylation at the University of Edinburgh, UK, calls it one of many "false alarms". He showed in 2001 that mice lacking the Mbd2 gene have normal patterns of DNA methylation, suggesting that it does not have a demethylase role9. The crucial missing piece, he says, is a pure biochemical demonstration of enzymatic activity. "No one can take a piece of methylated DNA, mix it with some enzyme in vitro and demethylate it. It doesn't mean it can't happen, but show me the incontrovertible evidence." "No one can take methylated DNA, mix it with enzymes" Another issue is that the methylation changes documented by that Meaney, Szyf, Champagne and others seem trivially tiny, appearing on only a handful of nucleotides in a small region of a gene, for example. And those changes only occur in a fraction of the total cells. To epigeneticists who study robust changes in methylation such as those that occur in embryos and zygotes, this looks like noise. It is also unclear whether these changes are actually happening in neurons. They could, for example, be happening in glia, cells that mainly provide support and protection for neurons. "Quite often one sees statistically significant differences in DNA methylation but they're very small," says Bird. "The question is, are they biologically significant in addition to statistically significant?" Frances Champagne (left), postdoc Nada Borghol and Moshe Szyf study epigenetics in rodents and humans.O. EGAN Proponents are unfazed by the wall of scepticism. Szyf insists that his group has shown that small changes make a difference. In their human study, he says, "we only got a few cytosines methylated, and that made us worried". So they engineered a version of the DNA region they were studying — near a glucocorticoid receptor gene — that had only those specific sites methylated. It shut down gene expression for cells in a dish6. Bestor, still unconvinced, responds that because the researchers only provide percentages of methylation in the brain, it is hard to tell whether any given cell would actually have all the sites methylated. As for the demethylase, Champagne says one has to exist. "There's a chemical reaction. DNA methyl groups are coming off. So there has to be an enzyme to do it." Plant cells have a well characterized demethylase, and many suspect that one will turn up in animal cells. Szyf, moreover, stands by the Mbd2 findings that Bird could not corroborate. As for the size of the changes, Champagne understands why many molecular biologists are wary. "If you're used to seeing effect sizes in a cell-culture dish, the kinds of effect sizes reported in behavioural models might mean nothing to you," she says. "If you saw that effect in a dish, it'd be error." But she points out that small changes can have big effects in the nervous system. "With behaviour, it's so dependent on where the changes are happening in the brain, what part of the circuits are affected," says Champagne. She acknowledges, however, that there are still many unknowns. She also appreciates that scepticism is healthy for the field, which even she thinks may be getting too hot, too fast. Critics, she says, "keep everyone honest. The enthusiasm in the field is obviously great, but I think people's expectations of what this means need to chill out a little bit. There are a few things we need to work out". "People's expectations of what this means need to chill out a little bit. There are a few things we need to work out." Szyf says, however, that the responses to behavioural epigenetics reflect a difference in ethos in fields that need to come together. "The psychiatry field is glad to have this mechanism they were missing," he says. "It was the thing that bothered them and now it's like, 'Oh wow, this makes so much sense.' But then the epigeneticists say, 'Oh come on, that's just magic.'" Szyf says that almost all of the papers that cite his and Meaney's 2004 study are from the behavioural sciences — not genetics or molecular biology. Some molecular biologists are warming to the idea, however. "We're starting to see this in more than one gene, more than one neuronal region," says Huda Zoghbi, a geneticist at Baylor College of Medicine in Houston, Texas, who studies the role of DNA methylation in a form of mental retardation. "There are a few issues, but I think it's intriguing and we really have to take stock in it, and start thinking about how this is happening." Determining exactly how it is happening remains the challenge. Even if researchers can work out how methyl marks are removed from a gene, they have to show the mechanism by which a life experience such as maternal care would cause that change. Meaney has proposed that mother rats' licks increase levels of the neurotransmitter serotonin, and that this increase could result in methylation changes, but no experiments have provided evidence that would explain how this link would work. ADVERTISEMENT The behavioural epigeneticists know they have work to do to answer the criticisms and they are setting about doing it. Szyf's lab is using a technique that can separate neurons from glia and other cell types so he can work out where the methylation is occurring, and Meaney says experiments are in progress to understand the series of events by which the environment might be altering methylation. Champagne is working with mice in hopes of doing more genetic experiments, and says that behavioural scientists are increasingly collaborating with classically trained molecular biologists. She has recently hired a postdoc trained in epigenetics. "The question always becomes, how do you transduce a social experience to the level of DNA methylation? Right now it's very speculative. We don't know. To really study that, you have to go back to a dish, ultimately." Until these sorts of hard data arrive, many molecular biologists say that they will stay in the sceptics' corner. "It's an interesting possibility, but I do think people have jumped the gun and seen more positive results than are really out there," says Bird. "I'm perfectly happy to believe that it's very important, but I'm also happy to believe that it's irrelevant." Lizzie Buchen is a freelance writer based in San Francisco, California. * References * Cameron, N. M. , Fish, E. W. & Meaney, M. J.Horm. Behav.54, 178-184 (2008). * MacLeod, A. R. & Szyf, M.J. Biol. Chem.270, 8037-8043 (1995). * Weaver, I. C. G.et al. Nature Neurosci.7, 847-854 (2004). * Murgatroyd, C.et al. Nature Neurosci.12, 1559-1566 (2009). * Roth, T. L. & Sweatt, J. D.Horm. Behav. doi:10.1016/j.yhbeh.2010.05.005 (2010). * McGowan, P. O.et al. Nature Neurosci.12, 342-348 (2009). * Gregory, S. G.et al. BMC Med.7, 62 (2009). * Bhattacharya, S. K. , Ramchandani, S. , Cervoni, N. & Szyf, M.Nature397, 579-583 (1999). * Hendrich, B. , Guy, J. , Ramsahoye, B. , Wilson, V. A. & Bird, A.Genes Dev.15, 710-723 (2001). There are currently no comments. This is a public forum. Please keep to our Community Guidelines. You can be controversial, but please don't get personal or offensive and do keep it brief. Remember our threads are for feedback and discussion - not for publishing papers, press releases or advertisements. - Geology: A trip to dinosaur time
- Nature (London) 467(7312):150 (2010)
A project to drill a 10-kilometre-deep hole in China will provide the best view yet of the turbulent Cretaceous period. Jane Qiu reports. Download a PDF of this story. The rock columns on the table are not much to look at. More than a metre long, 10 centimetres in diameter and mostly made up of oil shale and sandstone, they are a dull greyish green. But these, says Wang Chengshan, a geologist at the China University of Geosciences in Beijing, "are not ordinary rocks". Taken from depths of more than 2 kilometres into the Songliao Basin in northeastern China (see map), the rocks may hold clues to one of the strangest and most dynamic ages of Earth's history: the Cretaceous period. Beginning about 145 million years ago, the Cretaceous was the heyday of the dinosaurs. It was a time of climatic extremes, when global temperatures exceeded even the most alarming forecasts for the greenhouse world of 2100, and sea levels were up to 250 metres higher than today, covering about one-third of the current landmass. It was also a period of great geological and biological unrest, associated with frequent volcanic eruptions, the formation of major mountain ranges and ocean oxygen depletion. And it ended in spectacular style, with the global catastrophe that saw off dinosaurs some 65 million years ago, an event known as the Cretaceous/Palaeogene (K/Pg) extinction. Earth scientists have pieced together their understanding of conditions in the Cretaceous mainly from sediment cores drilled from the bottom of the ocean. But the cores being drilled from an oilfield in the Songliao Basin — which could eventually extend 10 kilometres deep — promise the deepest and best record yet of what was happening on land, and a chance to understand what drove the extremes of the time. "They are the key to unlocking the secrets of that fascinating period of Earth's history," says Wang, who, as the lead principal investigator, chaired a workshop in Beijing in early July on the Songliao Scientific Drilling Project. The cores that the researchers have seen so far, from depths of up to 2.5 kilometres, have offered insight into the Cretaceous climate and its massive fluctuations in temperature, atmospheric carbon dioxide and lake levels. The team is now hoping to muster support for a push to the very bottom of the basin, a further 7.5 kilometres down, whe! re the rocks should date from before the start of the Cretaceous. Deep details The peculiar geology of the basin allows researchers to look at the record in extraordinary detail. Ten kilometres deep and covering an area of 260,000 square kilometres, Songliao is a rift basin that was formed as Earth's crust was pulled apart by the same tectonic forces that transport continents over geological time. For nearly 100 million years, mostly during the Cretaceous, it was home to a series of gigantic lakes fed by vast rivers. "You just don't have something like this anywhere else on the planet." The lakes seem to have captured in their sediments an uninterrupted record of climate and environmental indicators. "Most lakes are rather ephemeral," says Judith Parrish, a palaeoclimatologist at the University of Idaho in Moscow. "It is extremely rare to find a palaeo-lake as large and long-lived as Songliao." This geological record is, in effect, "an encyclopaedia of the Cretaceous", says Stephan Graham, a sedimentary geologist at Stanford University in California, and one of the five principal investigators now involved in the project. "You just don't have something like this anywhere else on the planet." Core segments are stored in a facility in Daqing, China.S. A. GRAHAM The Songliao Basin is home to the Daqing oilfield, the largest oilfield in China. Chinese geologists had already drilled more than 50,000 wells across the basin and generated a comprehensive picture of the region. This type of drilling does not generally take cores, which is a much more costly enterprise — but it has helped researchers to select the best spot for the core drilling, where rock layers have not slid apart or folded together to complicate the geological record. The Daqing Oilfield Company in Heilongjiang province contributed half of the 10-million-yuan (US$1.3-million) cost of drilling out the 2,500-metre core, which started in 2006, and China's science ministry and various research institutions have also contributed to the drilling and analyses. On the basis of the early results, the project won endorsement in 2009 from the International Continental Scientific Drilling Programme (ICDP), which is run by experts at research institutions and funding bodies world! wide. A one-third segment of the entire length of the core is now sealed in transparent bags to protect its original shape and structure from drying and disintegrating. Time of great unrest Preliminary analyses have offered a glimpse of terrestrial conditions in the Middle and Late Cretaceous, adding to what was known from marine cores. "It seems to be a time of great unrest with a lot of ups and downs," says Wang. The team analysed oxygen and carbon isotopes in fossil crustacean shells as a proxy for ancient temperature and carbon dioxide levels, finding that atmospheric CO2 levels doubled and then halved over 3 million years in the Late Cretaceous. (The team is putting together its results for publication.) The same techniques showed that the temperature plunged by more than 7 °C during a 10-million-year period — possibly around the Cretaceous 'super greenhouse', when global temperatures were substantially higher than today. The lake levels also seemed to have fluctuated greatly: the researchers discovered signs of surface soil in a few core segments, suggesting that the basin might have completely dried out a few times. If proved correct, this could help to build up a picture of the climate dynamics behind these dry periods, says Parrish. The researchers hope to flesh out this picture, and pinpoint the causes of the climatic fluctuations with further analyses of the sediment compositions. They also want to examine the sources of the sediments and water that entered the lake by using isotopes of elements such as strontium. Deltas contained in the Songliao Basin are likely to be as large as the modern Nile Delta, so rivers that fed the lake may have flowed for hundreds or thousands of kilometres, leaving deposits that could provide insight into geological and ecological events in distant areas. The Songliao core may also shed fresh light on a contentious scientific debate: whether a large ice cap, half the size of the modern Antarctic ice cap, existed during a period as hot as the Cretaceous super greenhouse1. A more detailed temperature record built from the core might, for example, show whether there were more short cooling periods, such as the 7 °C drop the team has already observed. And the core could answer pressing questions about the K/Pg extinction, which many researchers believe was caused by an asteroid or comet strike at Chicxulub on Mexico's Yucatán Peninsula, and the climatic aftershock2. Most of the samples corroborating the theory have come from marine sediments. A terrestrial record at Songliao could reveal how the asteroid strike affected life on land, at a huge distance from the impact. "Sediment cores from Songliao will help to build a more complete picture of those extraordinary events," says Christian Koeberl, director of the Natural History Museum in Vienna and another principal investigator on the Songliao project. The key to answering all of these questions will be accurate dating of the core. This will help to correlate the Songliao records with their marine counterparts. "Without a precise timescale, the values of any other pieces of information that can be recovered from the core would be diminished tremendously," says Bradley Singer, a geochronologist at the University of Wisconsin–Madison. To date the core, Deng Chenglong, a geophysicist at the Chinese Academy of Sciences' Institute of Geology and Geophysics in Beijing, and his colleagues took samples every half-metre along it and measured the orientation of magnetic mineral grains in nearly 4,400 samples. The iron-rich grains in every rock layer point in the direction of Earth's magnetic field at the time the rock was forming. That field flips its polarity every few hundred thousand years, and those reversals get imprinted in the rocks. Magnetic calendar Deng and his team established a rough magnetic calendar for the Songliao core, which they could then compare with the global geomagnetic record. But to make an accurate match, the researchers needed to scour the core for volcanic layers — enriched in isotopes of uranium and other elements — which can be dated using the known rates of radioactive decay. They identified a handful of centimetre-thick ash beds with enough material for such dating, and they hope to find more. Other as-yet-unpublished results also point to a possible position for the K/Pg boundary. But it is about 100 metres below the depth determined by Wan Xiaoqiao, a palaeontologist at the Beijing-based China University of Geosciences who used fossils of spores, pollen, phytoplankton and ostracod to locate the boundary. The researchers are trying to determine why the estimates differ, and to nail the boundary down to 2–3 metres, so that detailed geochemical analyses can be performed to look for rare elements, such as iridium, that are common in meteorites and were spread around the globe by the cosmic impact. ADVERTISEMENT The second phase of the drilling, an extra 7.5 kilometres, is contingent on further funding. The ICDP will provide $1.3 million, and Wang hopes to get another 200 million yuan for the drilling operation from the Chinese government. It is not yet clear whether the Daqing Oilfield Company will continue to offer substantial financial support. Feng Zhiqiang, a geologist and vice-president of the company, hopes that the drilling project will result in a better understanding of the geological composition and sedimentation processes of the basin. "The knowledge will ultimately help us to locate new resources more efficiently," he says. Wang is more excited about the science. He picks up a rock segment, his eyes instantly lighting up, and weighs it in his hand. "This is not the end," he says. "It is just the beginning of an exciting scientific adventure." Jane Qiu writes for Nature from Beijing. * References * Bornemann, A.et al. Science319, 189-192 (2008). * Schulte, P.et al. Science327, 1214-1218 (2010). There are currently no comments. This is a public forum. Please keep to our Community Guidelines. You can be controversial, but please don't get personal or offensive and do keep it brief. Remember our threads are for feedback and discussion - not for publishing papers, press releases or advertisements. - Big projects would be shooting in the dark without team effort
- Nature (London) 467(7312):153 (2010)
In your Column (Nature466, 919; 2010), the story about me, Congressman Dana Rohrabacher and my pistols is not quite accurate. Neither did the Manhattan Project leave scientists with the belief that they could run their own projects by themselves. - Urban ecosystems research joins mainstream ecology
- Nature (London) 467(7312):153 (2010)
Nature | Correspondence | Opinion Urban ecosystems research joins mainstream ecology * Paul Mayer1mayer.paul@epa.gov Search for this author in: * NPG journals * PubMed * Google ScholarJournal name:NatureVolume: 467 ,Page:153Date published:(09 September 2010)DOI:doi:10.1038/467153bPublished online08 September 2010 Your call for more investigation into the ecology of urban habitats (see Nature ; 2010) is already being answered. In 1997, the US National Science Foundation's Long-Term Ecological Research programme created urban research sites in Baltimore, Maryland, and in Phoenix, Arizona. And last year the foundation funded the Urban Long-Term Research Area Exploratory Awards with the US Forest Service to expand knowledge of urban natural resources and human interactions. These programmes attest to a coordinated and productive effort to incorporate urban research into mainstream ecology. View full text Subject terms: * Ecology * Sociology * Conferences and meetings * Publishing Author information * Author information * Supplementary information * Comments Article tools * Full text * Print * Email * Download PDF * Download citation * Order reprints * Rights and permissions * Share/bookmark * Connotea * CiteULike * Facebook * Twitter * Delicious * Digg Affiliations * US Environmental Protection Agency, Ada, Oklahoma 74820, USA mayer.paul@epa.gov * Paul Mayer Supplementary information * Author information * Supplementary information * Comments PDF files * Supplementary Information (35K) Additional data - A call for action to curb invasive species in South America
- Nature (London) 467(7312):153 (2010)
South America's exceptional biodiversity is in danger of being overwhelmed by invading species. The continent urgently needs to muster a common strategy of regional action against this threat. - Chinese journal finds 31% of submissions plagiarized
- Nature (London) 467(7312):153 (2010)
Since October 2008, we have detected unoriginal material in a staggering 31% of papers submitted to the Journal of Zhejiang University–Science (692 of 2,233 submissions). The publication, designated as a key academic journal by the National Natural Science Foundation of China, was the first in China to sign up for CrossRef's plagiarism-screening service CrossCheck (Nature466, 167; 2010). - Time to automate identification
- Nature (London) 467(7312):154 (2010)
Taxonomists should work with specialists in pattern recognition, machine learning and artificial intelligence, say Norman MacLeod, Mark Benfield and Phil Culverhouse — more accuracy and less drudgery will result. - Chronicle of cybernetics pioneers
- Nature (London) 467(7312):156 (2010)
Rodney Brooks enjoys an account of the freewheeling group of post-war British researchers that sowed the seeds of robotics through a desire to imitate animal brains and behaviour. - Lessons from Climategate
- Nature (London) 467(7312):157 (2010)
After three inquiries, thousands of column inches and several death threats, the 'Climategate' affair is now subsiding into the long grass of conspiracy blogs. The rigour and honesty of the scientists involved in the furore sparked last November by the leaking of private e-mails from the Climatic Research Unit at the University of East Anglia in Norwich, UK, have been upheld. - Monkey business
- Nature (London) 467(7312):158 (2010)
Walton Ford's painting of a historical primate banquet belongs to a rich tradition of exploring the 'human animal', explains Martin Kemp. - Evolutionary biology: Communication and speciation
- Nature (London) 467(7312):159 (2010)
An electrifying evolutionary radiation has evidently occurred among elephant fish in Africa's Ivindo basin. An implication is that open niches for communication can result in species diversification. - Climate change: A glacial test of timing
- Nature (London) 467(7312):160 (2010)
Meticulous reconstruction of the former extent of a glacier high in the mountains of New Zealand will help in interpreting global-scale climatic adjustments that occurred at the end of the last glaciation. - Gene targeting: Enter the rat
- Nature (London) 467(7312):161 (2010)
Advances in stem-cell technology have broken the barrier to gene targeting in mammals other than mice. A wide array of research opportunities now opens up, especially in studies involving the laboratory rat. - 50 & 100 years ago
- Nature (London) 467(7312):163 (2010)
We wish to report new findings which demonstrate that the cytoplasm can be removed from an amœba in a state in which it displays continuous and vigorous streaming in vitro for periods as long as an hour ... The streaming of amœba cytoplasm in the absence of the plasmalemma and ectoplasmic tube as structures completely eliminates the sol-gel or ectoplasmic contraction theory ... The results of the present work provide additional evidence that the endoplasm of the amœba is not a structureless sol, but rather a material which is structurally and physiologically organized and capable of carrying on cytoplasmic streaming at the subcellular level. The partial disintegration of cytoplasm dissociated from giant amœbæ into 'motile units of streaming' provides evidence ... for the fountain zone contraction theory of amœboid movement. - Systems biology: The cost of feedback control
- Nature (London) 467(7312):163 (2010)
Noise in biochemical processes can compromise precision in cellular functions. An analysis involving information theory suggests that there is a strict limit to how far noise can be suppressed by feedback. - Nanotechnology: Holes with an edge
- Nature (London) 467(7312):164 (2010)
Tiny holes have been drilled through individual layers of graphene — atomically thin sheets of carbon — using an electron beam. These nanopores might be useful for the ultrarapid sequencing of single DNA molecules. - Functional roles for noise in genetic circuits
- Nature (London) 467(7312):167 (2010)
Nature | Review Functional roles for noise in genetic circuits * Avigdor Eldar1, 2 Search for this author in: * NPG journals * PubMed * Google Scholar * Michael B. Elowitz1melowitz@caltech.edu Search for this author in: * NPG journals * PubMed * Google Scholar * Affiliations * Corresponding authorJournal name:NatureVolume: 467 ,Pages:167–173Date published:(09 September 2010)DOI:doi:10.1038/nature09326 Article tools * Full text * 日本語要約 * Print * Email * Download PDF * Download citation * Order reprints * Rights and permissions * Share/bookmark * Connotea * CiteULike * Facebook * Twitter * Delicious * Digg The genetic circuits that regulate cellular functions are subject to stochastic fluctuations, or 'noise', in the levels of their components. Noise, far from just a nuisance, has begun to be appreciated for its essential role in key cellular activities. Noise functions in both microbial and eukaryotic cells, in multicellular development, and in evolution. It enables coordination of gene expression across large regulons, as well as probabilistic differentiation strategies that function across cell populations. At the longest timescales, noise may facilitate evolutionary transitions. Here we review examples and emerging principles that connect noise, the architecture of the gene circuits in which it is present, and the biological functions it enables. We further indicate some of the important challenges and opportunities going forward. View full text Subject terms: * Molecular biology * Biophysics * Stem cells * Evolution Figures at a glance * Figure 1: Gene expression noise is ubiquitous, and affects diverse systems at several levels. , E. coli expressing two identical promoters driving two different fluorescent proteins, in red and green, respectively. Because of noise, the ratio of red to green intensity differs from cell to cell22. , A clonal population of B. subtilis cells differentiate into different fates in the same conditions. Here, some cells grow vegetatively or sporulate (green fluorescence), others have completed sporulation (white), and one has differentiated into a state of genetic competence (red fluorescence). Image provided by G. Süel. , Mouse embryonic stem cells show relatively homogeneous expression of Oct4 (red nuclear protein staining), but heterogeneous expression of Nanog (green nuclear protein staining). Image provided by F. Tan. , The C. elegans skn-1 mutant shows noise-driven partial penetrance. Two genetically identical embryos are shown. One has developed a gut (elt-2 RNA staining, red) whereas the other has not (nuclei in blue). Image provided by A. Raj. , Mechanisms that sh! ape noise in gene expression. Noise is characterized by bursty expression of mRNA (top). Proteins typically have longer lifetimes than bursts, leading them to time-average or 'buffer' these bursts (middle). Finally, noise in one gene can propagate to generate further noise in the expression of downstream genes (bottom). * Figure 2: Frequency modulation of stochastic nuclear localization bursts enables coordination of gene regulation. , In yeast, calcium activates calcineurin, which in turn dephosphorylates the phosphorylated form of Crz1 (Crz1P) transcription factor, causing its localization to the nucleus where it activates over 100 target genes (two are indicated schematically). , Response curves showing expression of the two hypothetical target genes as a function of nuclear Crz1 level. As shown here, target promoters may vary in the effective affinity and sharpness of response to Crz1. , , Regulation of the two target genes in amplitude-modulation and frequency-modulation schemes. , In amplitude-modulation regulation, low levels of calcium lead to more expression of B than A, whereas the reverse is true at high levels (green and blue dots indicate newly produced proteins of genes A and B, note the step in calcium, above (red)). The resulting gene expression profiles (normalized to their own maxima) therefore differ between genes. , In a frequency-modulation model, each burst yields (on average) the s! ame number of proteins from each gene (blue and green dots). Increased calcium levels increase the frequency of bursts and thus the total level of expression of both A and B without affecting their ratio. Gene expression therefore follows the frequency response, regardless of the differences between promoters, enforcing coordination. * Figure 3: Probabilistic differentiation. , Schematic illustrations of three distinct modes of probabilistic differentiation (top) and corresponding time traces (below), as indicated. , Noise in the lac system. Top, schematic view of the lac-positive feedback loop: increased expression of the LacY transporter (green cylinder) increases intracellular inducer levels (light blue circle), inhibiting the LacI repressor (dark blue) and further increasing expression. Bottom, lacY expression is blocked upon simultaneous binding of LacI to two operator sites on the lac promoter, which forms a DNA loop. Unbinding from one of these sites leads to transcription of at most one mRNA before re-looping, causing small increases in LacY. More rarely, LacI will be completely released from both sites, resulting in a large burst of mRNA and proteins that may lead to a switch of the positive feedback loop. –, Probabilistic differentiation in embryonic stem cells. , Expression of Nanog (red) and Gata6 (green) in individual cells in the ! inner cell mass of a mouse embryo. Note the predominantly exclusive but spatially disorganized expression of the two genes. DAPI, 4′,6-diamidino-2-phenylindole. Image adapted with permission from ref. 59. , , Two models for patterning of the inner cell mass (ICM). , In a positional model cell, fate is determined by position through signalling from neighbouring cells. , In the stochastic sorting model, cells first differentiate randomly, and subsequently move to appropriate positions based on their identity. , Stem cell populations are not homogeneous but rather consist of a dynamic distribution of sub-states (dim green and red circles). Some sub-states resemble the differentiated states to which they are more prone to differentiate (bright green and red circles). * Figure 4: Roles of noise in evolution. –, How genetically controlled noise in a quantitative trait could respond to directional selection. , Directional selection for values of the trait above a threshold (black line and arrow) can lead to reduced noise when the threshold is low. Thus, the noisier distribution (blue line) has less area above the threshold (cross-hatch) than a less noisy distribution (green line, grey shading) with the same mean. , By contrast, when selection is tighter, the noisier distribution is favoured, as shown by the larger above-threshold area under the blue distribution compared to the green distribution. , Over evolutionary timescales, noise (σ, defined as the standard variation of the distribution) would thus be expected to increase under tight selection and decrease under weak selection. In both cases, selection would also increase the mean value of the trait (not shown). –, Noise enables the generation of partially penetrant alternative cell fates, which facilitate discrete evolu! tionary changes. , Wild-type B. subtilis cells (top) contain two chromosomes (yellow circles) when they initiate sporulation by an asymmetric division (red line). This event leads to differentiation of the forespore (smaller compartment) followed by the mother cell (larger compartment), and eventually results in formation of a single spore (white circle). Mutations can increase the frequency with which cells acquire an extra chromosome (yellow lightning) and/or an extra compartment (red lightning). Cells with both characteristics form two mature spores from a single sporulating cell (twins). , Depending on the number of chromosomes and compartments, single cells show four distinct fates, each of which has a specific fitness (the corners of the square), assumed to be proportional to the expected number of spores it will produce. Evolution from mono-spores to twins would be difficult with a single mutation (curved arrow) as it would have to affect both septation and replicati! on. However, several mutations affecting the penetrance of ext! ra chromosomes and extra compartments can allow a gradual increase in the mean fitness of the population (path with multiple arrows). WT, wild type. , This allows a gradual evolutionary transition from a homogenous population of mono-spores, to a partially penetrant intermediate population of multiple fates, to a homogenous population of twin spores. Author information * Author information * Comments Affiliations * Howard Hughes Medical Institute, Caltech M/C 114-96, 1200 East California Boulevard, Pasadena, California 91125, USA * Avigdor Eldar & * Michael B. Elowitz * Present address: Department of Molecular Microbiology and Biotechnology, Tel Aviv University, Tel Aviv 69978, Israel. * Avigdor Eldar Competing financial interests The authors declare no competing financial interests. Corresponding author Correspondence to: * Michael B. Elowitz (melowitz@caltech.edu) Additional data - Fundamental limits on the suppression of molecular fluctuations
- Nature (London) 467(7312):174 (2010)
Nature | Article Fundamental limits on the suppression of molecular fluctuations * Ioannis Lestas1 Search for this author in: * NPG journals * PubMed * Google Scholar * Glenn Vinnicombe1gv@eng.cam.ac.uk Search for this author in: * NPG journals * PubMed * Google Scholar * Johan Paulsson2johan_paulsson@hms.harvard.edu Search for this author in: * NPG journals * PubMed * Google Scholar * Affiliations * Contributions * Corresponding authorsJournal name:NatureVolume: 467 ,Pages:174–178Date published:(09 September 2010)DOI:doi:10.1038/nature09333Received01 November 2009Accepted08 July 2010 Abstract * Abstract * Author information * Supplementary information * Comments Article tools * Full text * 日本語要約 * Print * Email * Download PDF * Download citation * Order reprints * Rights and permissions * Share/bookmark * Connotea * CiteULike * Facebook * Twitter * Delicious * Digg Negative feedback is common in biological processes and can increase a system's stability to internal and external perturbations. But at the molecular level, control loops always involve signalling steps with finite rates for random births and deaths of individual molecules. Here we show, by developing mathematical tools that merge control and information theory with physical chemistry, that seemingly mild constraints on these rates place severe limits on the ability to suppress molecular fluctuations. Specifically, the minimum standard deviation in abundances decreases with the quartic root of the number of signalling events, making it extremely expensive to increase accuracy. Our results are formulated in terms of experimental observables, and existing data show that cells use brute force when noise suppression is essential; for example, regulatory genes are transcribed tens of thousands of times per cell cycle. The theory challenges conventional beliefs about biochemica! l accuracy and presents an approach to the rigorous analysis of poorly characterized biological systems. View full text Subject terms: * Biophysics * Mathematics * Statistics * Cell biology * Applied physics * Engineering Figures at a glance * Figure 1: Schematic of optimal control networks and information loss. Biological networks can be overwhelmingly complex, with numerous feedback loops and signalling steps. Predictions about noise then rely on quantitative estimates for how every probabilistic reaction rate responds to every type of perturbation. To investigate bounds on behaviour, most of the network is here replaced by a 'control demon' representing a controller that is optimized over all possible network topologies, rates and mechanisms. The bounds are then calculated in terms of the few specified features. * Figure 2: Hard limits on standard deviations. , Intrinsic noise (equation (1)): the lower limit on the relative standard deviation normalized by that of a Poisson distribution, as a function of the ratio N2/N1. The blue curve corresponds to the reaction scheme in equation (1), and the red curve corresponds to the autocatalytic scheme described above equation (5). The quartic root is the strongest relative response along either curve, and at low relative signalling frequencies the limit is an even more damped function of N2/N1. Inset, the same lower limit for an average of 100 X1 molecules, as a function of N2. , Extrinsic noise: X1 is made at rate x3u, where X3 is born with constant probability and decays exponentially with rate 1/τ3, and intrinsic birth and death noise in X1 is ignored. For τ3 τ1 and τ3 τ1, the quartic-root asymptotic still applies, essentially because the process mimics a one-variable random process in both cases. At intermediate timescales, the N2 dependence is less strict and τ3 = τ! 1 produces an asymptotic power-law exponent of 3/8 rather than 1/4, partly supporting previous6, 16 conclusions that extrinsic noise is slightly easier to suppress. However, many actual control systems may find intermediately slow noise the hardest to eliminate, and any predictions about suppressing extrinsic noise will depend on the properties of that noise. The predicted extrinsic noise limit is also a conservative estimate, and the actual magnitude of the noise limit may be slightly higher (Supplementary Information). * Figure 3: Plasmid replication control. , Plasmid ColE1 expresses an inhibitor that prevents replication, similarly to the self-replication model in the main text with X1 as plasmid and X2 as inhibitor. Because plasmids are under selection for noise suppression, the theory predicts it must maximize expression rates and minimize the length of signalling cascades while still achieving 'cooperative' nonlinear effects in the control loop. ColE1 indeed expresses a short-lived antisense RNA inhibitor (RNA I), tens of thousands of times per cell cycle (~10 Hz), that directly and irreversibly blocks the maturation of a constitutively synthesized sense-RNA replication pre-primer (RNA II)5—eliminating both the translation step and binding and unbinding to genes, and making it energetically and mechanistically possible to produce inhibitors at such high rates. ColE1 could also create strongly nonlinear control kinetics by exploiting kinetic proofreading in RNA II elongation5, 27. Many unrelated plasmids similarly exp! ress antisense inhibitors at high rates, avoid cascades and use multistep inhibition kinetics. , Plasmids such as P1, F and pSC101 use 'handcuffing' mechanisms, where repeated DNA sequences (iterons) bind each other and prevent replication28. This can achieve similar homeostatic dynamics as monomer–dimer equilibria where a higher fraction of molecules are in dimer form at higher abundance. Using DNA itself as inhibitor, this could eliminate the need for indirect signalling altogether, but because the mechanisms seem incapable of strongly nonlinear corrections28, most such plasmids use additional control systems that go through gene expression and thus are subject to information loss. Plasmids also commonly use counteracting loops, where replication inhibitors also auto-inhibit their own synthesis—a counterintuitive strategy that in fact can improve control greatly (increasing H22 for a given, high H21 in equation (4)). Author information * Abstract * Author information * Supplementary information * Comments Affiliations * Department of Engineering, University of Cambridge, Cambridge CB2 1PZ, UK * Ioannis Lestas & * Glenn Vinnicombe * Department of Systems Biology, Harvard University, Boston, Massachusetts 02115, USA * Johan Paulsson Contributions I.L., G.V. and J.P. contributed equally, and all conceived the study, derived the equations and wrote the paper. Competing financial interests The authors declare no competing financial interests. Corresponding authors Correspondence to: * Glenn Vinnicombe (gv@eng.cam.ac.uk) or * Johan Paulsson (johan_paulsson@hms.harvard.edu) Supplementary information * Abstract * Author information * Supplementary information * Comments PDF files * Supplementary Information (529K) This file contains Supplementary Information comprising: 1 Introduction; 2 Preliminaries; 3 The informationcapacity of molecular channels; 4 The bounds; 5 Serial and parallel cascades; 6 Tradeoffs; Supplementary Appendices A, B and C and additional references. Additional data - Enhancement of proteasome activity by a small-molecule inhibitor of USP14
- Nature (London) 467(7312):179 (2010)
Nature | Article Enhancement of proteasome activity by a small-molecule inhibitor of USP14 * Byung-Hoon Lee1, 5 Search for this author in: * NPG journals * PubMed * Google Scholar * Min Jae Lee1, 5 Search for this author in: * NPG journals * PubMed * Google Scholar * Soyeon Park1 Search for this author in: * NPG journals * PubMed * Google Scholar * Dong-Chan Oh2, 3 Search for this author in: * NPG journals * PubMed * Google Scholar * Suzanne Elsasser1 Search for this author in: * NPG journals * PubMed * Google Scholar * Ping-Chung Chen4 Search for this author in: * NPG journals * PubMed * Google Scholar * Carlos Gartner1, 6 Search for this author in: * NPG journals * PubMed * Google Scholar * Nevena Dimova1 Search for this author in: * NPG journals * PubMed * Google Scholar * John Hanna1, 6 Search for this author in: * NPG journals * PubMed * Google Scholar * Steven P. Gygi1 Search for this author in: * NPG journals * PubMed * Google Scholar * Scott M. Wilson4 Search for this author in: * NPG journals * PubMed * Google Scholar * Randall W. King1randy_king@hms.harvard.edu Search for this author in: * NPG journals * PubMed * Google Scholar * Daniel Finley1daniel_finley@hms.harvard.edu Search for this author in: * NPG journals * PubMed * Google Scholar * Affiliations * Contributions * Corresponding authorsJournal name:NatureVolume: 467 ,Pages:179–184Date published:(09 September 2010)DOI:doi:10.1038/nature09299Received22 April 2010Accepted14 June 2010 Abstract * Abstract * Author information * Supplementary information * Comments Article tools * Full text * 日本語要約 * Print * Email * Download PDF * Download citation * Order reprints * Rights and permissions * Share/bookmark * Connotea * CiteULike * Facebook * Twitter * Delicious * Digg Proteasomes, the primary mediators of ubiquitin–protein conjugate degradation, are regulated through complex and poorly understood mechanisms. Here we show that USP14, a proteasome-associated deubiquitinating enzyme, can inhibit the degradation of ubiquitin–protein conjugates both in vitro and in cells. A catalytically inactive variant of USP14 has reduced inhibitory activity, indicating that inhibition is mediated by trimming of the ubiquitin chain on the substrate. A high-throughput screen identified a selective small-molecule inhibitor of the deubiquitinating activity of human USP14. Treatment of cultured cells with this compound enhanced degradation of several proteasome substrates that have been implicated in neurodegenerative disease. USP14 inhibition accelerated the degradation of oxidized proteins and enhanced resistance to oxidative stress. Enhancement of proteasome activity through inhibition of USP14 may offer a strategy to reduce the levels of aberrant protei! ns in cells under proteotoxic stress. View full text Figures at a glance * Figure 1: USP14 is an inhibitor of the proteasome. , Ub–AMC hydrolysis assay of USP14 activity in the presence or absence of Ub–VS-treated human proteasome (VS-proteasome; 1 nM). RFU, relative fluorescence units. Ptsm, 26S proteasome. , In vitro degradation assay with polyubiquitinated CCNB (Ubn–CCNB), human proteasome (4 nM), and wild-type (WT) USP14 (USP14) or mutant USP14(C114A) (USP14(CA); 60 nM). Samples in , and – were analysed by SDS–PAGE/immunoblotting (IB). , Plasmids expressing tau, Flag–TDP-43, or V5–LacZ were co-transfected into Usp14−/− MEFs with variants of Flag–USP14 as indicated. Samples were collected 2 days after transfection. Actin, loading control. , Diagram of human USP14, showing ubiquitin-like (UBL) and catalytic (CAT) domains. C114, active site cysteine. Splice variant USP14(SF) is produced from an mRNA lacking exon 4 (ref. 12). , Flag-tagged ATXN3(Q22) or ATXN3(Q80) was co-expressed with USP14 variants in Usp14−/− MEFs and detected with anti-Flag antibodies. , Arg–GF! P or control Met–GFP co-expressed with USP14 variants in Usp14−/− MEFs. , As except HEK293 cells were used. , USP14(SF) associates with but is not activated by proteasomes. Each variant of Flag–USP14 was expressed in HEK293T cells containing tagged hRPN11, and proteasomes were affinity purified. Where indicated, Ub–VS was incubated with lysate before proteasome purification. Extract samples represent 5% of total. Asterisks indicate nonspecific signals. Proteasome subunit hRPN13, loading control. Control samples, empty vector. Equal cell numbers were used for each lane. * Figure 2: IU1 inhibits human USP14 specifically and reversibly. , Chemical structures of IU1 and IU1C. Analytical data shown in Supplementary Fig. 16. , IC50 determination for IU1 inhibition of Ub–AMC hydrolysis by proteasome-bound USP14 (4.7 ± 0.7 μM), IsoT (100 ± 0.4 μM) and UCH37 (700 ± 300 μM). , Ub–AMC (1 μM) hydrolysis assays showing specificity of IU1 for USP14 in comparison to eight other DUB enzymes. , Reversibility of USP14 inhibition. 60 nM USP14 and 5 nM human proteasome were treated with vehicle (DMSO) or 100 μM IU1 for 2 h. After rapid spin gel-filtration, proteins were assayed for Ub–AMC hydrolysis. All values are presented as mean ± s.d. (n = 3). * Figure 3: IU1 inhibits chain trimming and stimulates substrate degradation in vitro. , Chain-trimming assays. Samples contained 4 nM proteasome, and USP14 was added at 15-fold molar excess over proteasome. IU1 was added at 50 μM and proteasome inhibitors (PI) at 5 μM (PS-341, epoxomicin). Asterisk indicates CCNB species derived from residual thrombin from USP14 preparation16. All panels, SDS–PAGE/immunoblot analysis. , In vitro Ubn–CCNB degradation assay (IU1 at 34 μM). , In vitro degradation assay with polyubiquitinated, T7-tagged Sic1PY, human proteasome (5 nM) and wild-type USP14 (75 nM) in the absence or presence of IU1 (75 μM). * Figure 4: IU1 enhances proteasomal degradation in cells. All panels show SDS–PAGE/immunoblot data. , Thirty-six hours after co-transfecting wild-type MEFs with plasmids expressing tau and V5–LacZ, cells were incubated with 0, 25, 50, 75, or 100 μM of IU1 for 6 h. LacZ, transfection control. Actin, loading control. , As in except that MEFs were Usp14−/− and IU1 was at 0, 10, 50, or 100 μM. , Tau and Ub-independent proteasome substrate cODC–EGFP were co-expressed in wild-type MEFs and incubated with 50 μM IU1 for 6 h. Proteasome inhibitors were MG132 (30 μM) and PS-341 (10 μM). , As except with ATXN3(Q80) and ATXN3(Q22), and IU1 at 0, 50 and 100 μM. , Flag–TDP-43 was co-transfected with a LacZ-expressing plasmid into either wild-type or Usp14−/− MEFs, then treated with IU1 (75 μM) for the indicated time. Asterisk, nonspecific signal. , HA-tagged Ub and/or Flag-tagged TDP-43 were transiently overexpressed in wild-type MEFs with 50 μM IU1 incubation for 6 h. Proteasome inhibitors (20 μM MG132, ! 10 μM PS-341) were added 4 h before lysis. Lysates were subjected to immunoprecipitation with anti-HA or anti-Flag. Arrows indicate likely ubiquitinated TDP-43 species. HC, heavy chain. , Wild-type MEFs and Usp14−/− MEFs were treated with IU1 (0, 25, 50, 75, or 100 μM) for 6 h, followed by analysis for ubiquitin, actin, CP subunit α7 and RP subunit mRpt5. * Figure 5: IU1 alleviates cytotoxicity induced by oxidative stress. , HEK293 cells were pre-incubated with IU1 (75 μM) or proteasome inhibitors (20 μM MG132, 10 μM PS-341) for 4 h, then treated with menadione (300 μM) for 60 min. Lysates were treated with DNPH and immunoblotted with anti-DNP antibody to assay oxidized proteins. , Cell survival under oxidative stress measured using the MTT assay. HEK293 cells were pre-treated with 50 μM IU1 for 2 h. Menadione was added, followed by 4 h incubation. IU1 effects comparable to those of panels and were obtained in wild-type but not Usp14−/− MEFs (data not shown). Values are represented as mean ± s.d. (n = 3). Author information * Abstract * Author information * Supplementary information * Comments Primary authors * These authors contributed equally to this work. * Byung-Hoon Lee & * Min Jae Lee Affiliations * Department of Cell Biology, Harvard Medical School, 240 Longwood Avenue, Boston, Massachusetts 02115, USA * Byung-Hoon Lee, * Min Jae Lee, * Soyeon Park, * Suzanne Elsasser, * Carlos Gartner, * Nevena Dimova, * John Hanna, * Steven P. Gygi, * Randall W. King & * Daniel Finley * Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, 240 Longwood Avenue, Boston, Massachusetts 02115, USA * Dong-Chan Oh * Natural Products Research Institute, College of Pharmacy, Seoul National University, San 56-1, Sillim, Seoul 151-742, Republic of Korea * Dong-Chan Oh * Department of Neurobiology, Evelyn F. McKnight Brain Institute, Civitan International Research Center, University of Alabama at Birmingham, Birmingham, Alabama 35294, USA * Ping-Chung Chen & * Scott M. Wilson * Present addresses: Department of Biological Sciences, 193 Galvin Life Sciences Center, Notre Dame, Indiana 46556, USA (C.G.); Department of Pathology, Brigham and Women's Hospital, 75 Francis Street, Boston, Massachusetts 02115, USA (J.H.). * Carlos Gartner & * John Hanna Contributions B.-H.L. carried out screening and most in vitro studies, and M.J.L. chemical analysis and most cell-based assays. R.W.K. and D.F. were responsible for overall design and oversight of the project. S.P., S.E. and N.D. provided skilled assistance in proteasome biochemistry and assays. D.-C.O., C.G. and S.P.G. designed and carried out chemistry studies. P.-C.C., S.M.W. and J.H. provided key reagents and intellectual input. Many authors contributed to preparation of the manuscript. Competing financial interests There is a patent application on this work, filed by Harvard University on behalf of the authors. Corresponding authors Correspondence to: * Randall W. King (randy_king@hms.harvard.edu) or * Daniel Finley (daniel_finley@hms.harvard.edu) Supplementary information * Abstract * Author information * Supplementary information * Comments PDF files * Supplementary Information (3.9M) This file contains Supplementary Figures 1-29 with legends and additional references. * Supplementary Table (907K) This table contains a summary of nonspecific and weak hits. Additional data - High-resolution tunnelling spectroscopy of a graphene quartet
- Nature (London) 467(7312):185 (2010)
Nature | Letter High-resolution tunnelling spectroscopy of a graphene quartet * Young Jae Song1, 2 Search for this author in: * NPG journals * PubMed * Google Scholar * Alexander F. Otte1, 2 Search for this author in: * NPG journals * PubMed * Google Scholar * Young Kuk3 Search for this author in: * NPG journals * PubMed * Google Scholar * Yike Hu4 Search for this author in: * NPG journals * PubMed * Google Scholar * David B. Torrance4 Search for this author in: * NPG journals * PubMed * Google Scholar * Phillip N. First4 Search for this author in: * NPG journals * PubMed * Google Scholar * Walt A. de Heer4 Search for this author in: * NPG journals * PubMed * Google Scholar * Hongki Min1, 2 Search for this author in: * NPG journals * PubMed * Google Scholar * Shaffique Adam1 Search for this author in: * NPG journals * PubMed * Google Scholar * Mark D. Stiles1 Search for this author in: * NPG journals * PubMed * Google Scholar * Allan H. MacDonald5 Search for this author in: * NPG journals * PubMed * Google Scholar * Joseph A. Stroscio1joseph.stroscio@nist.gov Search for this author in: * NPG journals * PubMed * Google Scholar * Affiliations * Contributions * Corresponding authorJournal name:NatureVolume: 467 ,Pages:185–189Date published:(09 September 2010)DOI:doi:10.1038/nature09330Received07 March 2010Accepted07 July 2010 Article tools * Full text * 日本語要約 * Print * Email * Download PDF * Download citation * Order reprints * Rights and permissions * Share/bookmark * Connotea * CiteULike * Facebook * Twitter * Delicious * Digg Electrons in a single sheet of graphene behave quite differently from those in traditional two-dimensional electron systems. Like massless relativistic particles, they have linear dispersion and chiral eigenstates. Furthermore, two sets of electrons centred at different points in reciprocal space ('valleys') have this dispersion, giving rise to valley degeneracy. The symmetry between valleys, together with spin symmetry, leads to a fourfold quartet degeneracy of the Landau levels, observed as peaks in the density of states produced by an applied magnetic field. Recent electron transport measurements have observed the lifting of the fourfold degeneracy in very large applied magnetic fields, separating the quartet into integer1, 2, 3, 4 and, more recently, fractional5, 6 levels. The exact nature of the broken-symmetry states that form within the Landau levels and lift these degeneracies is unclear at present and is a topic of intense theoretical debate7, 8, 9, 10, 11. Here! we study the detailed features of the four quantum states that make up a degenerate graphene Landau level. We use high-resolution scanning tunnelling spectroscopy at temperatures as low as 10 mK in an applied magnetic field to study the top layer of multilayer epitaxial graphene. When the Fermi level lies inside the fourfold Landau manifold, significant electron correlation effects result in an enhanced valley splitting for even filling factors, and an enhanced electron spin splitting for odd filling factors. Most unexpectedly, we observe states with Landau level filling factors of 7/2, 9/2 and 11/2, suggestive of new many-body states in graphene. View full text Subject terms: * Materials science Figures at a glance * Figure 1: Landau level spectroscopy of epitaxial graphene on SiC. Tunnelling spectroscopy of the Landau level states in a plot of differential conductivity versus sample bias. Tunnelling parameters are as follows: set-point current, 400 pA; sample bias, −300 mV; modulation voltage, 1 mV. Left inset, high-resolution scanning tunnelling microscopy image of the graphene honeycomb lattice. Tunnelling parameters: set-point current, 100 pA; sample bias, −250 mV; T = 13 mK. Right inset, Landau level peak energy position (relative to the N = 0 level) versus the square root of NB. Excellent scaling is observed in the linear relationship, yielding a carrier velocity of (1.08 ± 0.03) × 106 m s−1 (1σ). * Figure 2: Landau levels of epitaxial graphene on SiC as a function of magnetic field. A series of dI/dV line scans, taken vertically through the moiré region in Supplementary Fig. 1, as a function of magnetic field. Each panel shows the dI/dV intensity in a colour scale (from −1 to 12 nS). The vertical axis within each panel is distance, D, from 0 to 40 nm. A splitting of the N = 0, 1 and 2 Landau levels can been seen in different field ranges. Tunnelling parameters: set-point current, 200 pA; sample bias, −250 mV; modulation voltage, 250 μV; T = 13 mK. * Figure 3: Electron density and filling-factor variation as a function of magnetic field in epitaxial graphene. , The electron density, n = νB/Φ0, determined from the filling of the Landau levels (red symbols), as a function of B, where ν is the filling factor and Φ0 is the flux quantum. The dashed blue lines correspond to densities at constant filling factors ranging from ν = 3 to 14. , The integral of the dI/dV spectra of the filled K′ valley (rightmost peaks in Fig. 4), from the middle of the N = 1 Landau level to zero sample bias, EF, as a function of field (Fig. 4). The plateaux correspond to stable filling factors. , Electron density versus B in the region around 11.5 T, showing the transitions between the half-filled states at ν = 9/2 and ν = 11/2 between ν = 4 and 5 and, respectively, ν = 5 and 6. Filling factors were determined by taking the ratio of the integrated areas in and dividing by the area of a single Landau level (area at ν = 5) and adding four (two for N = 0 and two for the K valley (leftmost peaks in Fig. 4)). The calculated filling factors are 5.46�! ��± 0.06, 4.54 ± 0.04 and 3.52 ± 0.05 (1σ). Error bars, 1σ. * Figure 4: High-resolution Landau level spectroscopy of the fourfold states that make up the N = 1 Landau level. , A series of dI/dV line scans focusing on the Fermi level region of the N = 1 Landau level (LL), made in the same spatial location as in Fig. 2. At 11.125 and 11.5 T, new stable half-filled Landau levels appear at filling factors of 11/2 and 9/2. , Single dI/dV spectra from the middle regions of the panels in for the indicated magnetic fields. The level separation energies are defined in the various panels. ΔEV, the lifting of the valley degeneracy (blue and red lines), is measured from the centres of the two spin-split states (see spectrum with B = 11.75 T). The yellow lines indicate the position of the Fermi level at zero sample bias. We define three energy separations for the spin split peaks: ΔESL and ΔESR for the left and right spin-split levels, respectively (B = 11 T); ΔESE measures the enhanced spin splitting when the Fermi level falls between the spin-split levels (B = 11.25 T); and ΔESF measures the separation between the two half-filled Landau levels! . , Tunnelling dI/dV spectrum at a filling factor of 7/2 showing a similar 1/2-fractional state when EF is positioned between the left two spin split states (K valley) at a higher magnetic field of 14 T. Note change in horizontal scale and position of EF.Tunnelling parameters: set-point current, 200 pA; sample bias, −250 mV, modulation voltage, 50 μV; T = 13 mK. * Figure 5: Energies in the epitaxial graphene N = 1 Landau level. , Valley splitting, ΔEV, measured for the N = 1 Landau level as a function of magnetic field. The solid blue line is a linear fit of the N = 1 data for fields less than 7 T. The linear fit yields the effective g-factor gV(LL1) = 18.4 ± 0.4 (1σ). The smooth cyan line is a guide to the eye and shows the N = 1 splitting peaking when EF is centred in the N = 1 Landau manifold at a filling factor of 4. Inset, schematic of the energy level structure of the N = 1 Landau level, showing the breaking of the valley symmetry, ΔEV, followed by the breaking of the spin symmetry, ΔES. , Spin level energy separations as functions of magnetic field. The solid lines are linear fits yielding the g-factors gSL = 2.36 ± 0.01 and gSR = 2.23 ± 0.01 (1σ). The level separation energies are defined in Fig. 4. Error bars, 1σ. Author information * Author information * Supplementary information * Comments Affiliations * Center for Nanoscale Science and Technology, NIST, Gaithersburg, Maryland 20899, USA * Young Jae Song, * Alexander F. Otte, * Hongki Min, * Shaffique Adam, * Mark D. Stiles & * Joseph A. Stroscio * Maryland NanoCenter, University of Maryland, College Park, Maryland 20742, USA * Young Jae Song, * Alexander F. Otte & * Hongki Min * Department of Physics and Astronomy, Seoul National University, Seoul, 151-7474, South Korea * Young Kuk * School of Physics, Georgia Institute of Technology, Atlanta, Georgia 30332, USA * Yike Hu, * David B. Torrance, * Phillip N. First & * Walt A. de Heer * Department of Physics, University of Texas at Austin, Austin, Texas 78712, USA * Allan H. MacDonald Contributions Y.J.S, A.F.O, Y.K. and J.A.S designed and constructed the millikelvin scanning probe microscopy system. The graphene scanning tunnelling microscopy/scanning tunnelling spectroscopy measurements were performed by Y.J.S, A.F.O and J.A.S. The graphene sample was grown by Y.H and W.A.d.H., and the surface was prepared and characterized by D.B.T and P.N.F. A theoretical analysis of the epitaxial graphene multilayer system was performed by H.M., S.A., M.D.S and A.H.M. Competing financial interests The authors declare no competing financial interests. Corresponding author Correspondence to: * Joseph A. Stroscio (joseph.stroscio@nist.gov) Supplementary information * Author information * Supplementary information * Comments PDF files * Supplementary Figures (365K) The file contains Supplementary Figures 1-2 with legends. Additional data - Graphene as a subnanometre trans-electrode membrane
Garaj S Hubbard W Reina A Kong J Branton D Golovchenko JA - Nature (London) 467(7312):190 (2010)
Nature | Letter Graphene as a subnanometre trans-electrode membrane * S. Garaj1sgaraj@fas.harvard.edu Search for this author in: * NPG journals * PubMed * Google Scholar * W. Hubbard2 Search for this author in: * NPG journals * PubMed * Google Scholar * A. Reina3 Search for this author in: * NPG journals * PubMed * Google Scholar * J. Kong4 Search for this author in: * NPG journals * PubMed * Google Scholar * D. Branton5 Search for this author in: * NPG journals * PubMed * Google Scholar * J. A. Golovchenko1, 2golovchenko@physics.harvard.edu Search for this author in: * NPG journals * PubMed * Google Scholar * Affiliations * Contributions * Corresponding authorsJournal name:NatureVolume: 467 ,Pages:190–193Date published:(09 September 2010)DOI:doi:10.1038/nature09379Received12 April 2010Accepted27 July 2010Published online18 August 2010 Article tools * Full text * 日本語要約 * Print * Email * Download PDF * Download citation * Order reprints * Rights and permissions * Share/bookmark * Connotea * CiteULike * Facebook * Twitter * Delicious * Digg Isolated, atomically thin conducting membranes of graphite, called graphene, have recently been the subject of intense research with the hope that practical applications in fields ranging from electronics to energy science will emerge1. The atomic thinness, stability and electrical sensitivity of graphene motivated us to investigate the potential use of graphene membranes and graphene nanopores to characterize single molecules of DNA in ionic solution. Here we show that when immersed in an ionic solution, a layer of graphene becomes a new electrochemical structure that we call a trans-electrode. The trans-electrode's unique properties are the consequence of the atomic-scale proximity of its two opposing liquid–solid interfaces together with graphene's well known in-plane conductivity. We show that several trans-electrode properties are revealed by ionic conductance measurements on a graphene membrane that separates two aqueous ionic solutions. Although our membranes ar! e only one to two atomic layers2, 3 thick, we find they are remarkable ionic insulators with a very small stable conductance that depends on the ion species in solution. Electrical measurements on graphene membranes in which a single nanopore has been drilled show that the membrane's effective insulating thickness is less than one nanometre. This small effective thickness makes graphene an ideal substrate for very high resolution, high throughput nanopore-based single-molecule detectors. The sensitivity of graphene's in-plane electronic conductivity to its immediate surface environment and trans-membrane solution potentials will offer new insights into atomic surface processes and sensor development opportunities. View full text Subject terms: * Materials science * Biophysics Figures at a glance * Figure 1: Diagram of our experiments. A graphene membrane was mounted over a 200 × 200 nm aperture in SiNx suspended across a Si frame (not to scale). The membrane separates two ionic solutions (not shown) in contact with Ag/AgCl electrodes (thick lines top and bottom, connected via a voltage source and a sensitive ammeter, A). Inset, cross-section through the Si frame, SiNx aperture, and the graphene membrane through which a nanopore has been drilled. * Figure 2: Trans-electrode I–V curves. Results for an as-grown graphene membrane (dashed line) and a membrane with an 8-nm pore (solid line). The ionic conductance of the pore is quantitatively in agreement with the modelling presented in the text. Applying bias voltages in excess of ~250 mV gradually degraded the insulating properties of the membranes. Insets, TEM images: top, a mounted graphene membrane; bottom, the 8-nm pore. * Figure 3: Graphene nanopore conductance. Filled circles, experimental results with a 1 M KCl solution of conductivity σ = 11 S m−1. Solid curve, modelled conductance of a 0.6-nm-thick insulating membrane, which is the best fit to the experimentally measured conductances. Error bars, s.d. of four diameter measurements along different nanopore axes. Modelled conductances for a 2-nm-thick membrane (dotted line) and a 10-nm-thick membrane (dashed-dotted line) are presented for comparison. * Figure 4: Average nanopore current blockades versus blockade duration during DNA translocation. DNA (16 μg ml−1) was electrophoretically driven through a 5-nm-diameter graphene pore by an applied voltage bias of 160 mV. The graphene membrane separated two fluid cells containing unbuffered 3 M KCl solutions, pH 10.4. Insets, typical current–time traces for two translocation events sampled from among those pointed to by the arrows. The hyperbolic curve corresponds to freely translocating events at a fixed e.c.d. (electronic charge deficit; ref. 12). Encircled events are delayed by graphene–DNA interactions. * Figure 5: Geometric resolution. Modelled nanopore conductance as the abrupt diameter decrease of a model molecule (inset) translocates through a 2.4-nm pore. The attainable resolution for two membranes of different insulating thicknesses (0.6 nm, solid curve; 1.5 nm, dotted curve) is assumed to be achieved when the measured current through the nanopore changes from 75% to 25% of the maximum blockade change that would occur as the model molecule translocates through the nanopore. Author information * Author information * Comments Affiliations * Department of Physics, Harvard University, Cambridge, Massachusetts 02138, USA * S. Garaj & * J. A. Golovchenko * School of Engineering and Applied Sciences, Harvard University, Cambridge, Massachusetts 02138, USA * W. Hubbard & * J. A. Golovchenko * Department of Materials Science and Engineering, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139, USA * A. Reina * Department of Electrical Engineering and Computer Science, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139, USA * J. Kong * Department of Molecular and Cellular Biology, Harvard University, Cambridge, Massachusetts 02138, USA * D. Branton Contributions Graphene samples were grown by J.K. and A.R. Experiments and calculations were performed by S.G. Other activities, including data interpretation, conclusions and manuscript writing, were performed collaboratively at Harvard University by S.G., W.H., D.B. and J.A.G. Competing financial interests The authors declare no competing financial interests. Corresponding authors Correspondence to: * J. A. Golovchenko (golovchenko@physics.harvard.edu) or * S. Garaj (sgaraj@fas.harvard.edu) Additional data - Glacier retreat in New Zealand during the Younger Dryas stadial
- Nature (London) 467(7312):194 (2010)
Nature | Letter Glacier retreat in New Zealand during the Younger Dryas stadial * Michael R. Kaplan1mkaplan@ldeo.columbia.edu Search for this author in: * NPG journals * PubMed * Google Scholar * Joerg M. Schaefer1, 2 Search for this author in: * NPG journals * PubMed * Google Scholar * George H. Denton3 Search for this author in: * NPG journals * PubMed * Google Scholar * David J. A. Barrell4 Search for this author in: * NPG journals * PubMed * Google Scholar * Trevor J. H. Chinn5 Search for this author in: * NPG journals * PubMed * Google Scholar * Aaron E. Putnam3 Search for this author in: * NPG journals * PubMed * Google Scholar * Bjørn G. Andersen6 Search for this author in: * NPG journals * PubMed * Google Scholar * Robert C. Finkel7, 8 Search for this author in: * NPG journals * PubMed * Google Scholar * Roseanne Schwartz1 Search for this author in: * NPG journals * PubMed * Google Scholar * Alice M. Doughty9 Search for this author in: * NPG journals * PubMed * Google Scholar * Affiliations * Contributions * Corresponding authorJournal name:NatureVolume: 467 ,Pages:194–197Date published:(09 September 2010)DOI:doi:10.1038/nature09313Received20 February 2010Accepted22 June 2010 Article tools * Full text * 日本語要約 * Print * Email * Download PDF * Download citation * Order reprints * Rights and permissions * Share/bookmark * Connotea * CiteULike * Facebook * Twitter * Delicious * Digg Millennial-scale cold reversals in the high latitudes of both hemispheres interrupted the last transition from full glacial to interglacial climate conditions. The presence of the Younger Dryas stadial (~12.9 to ~11.7 kyr ago) is established throughout much of the Northern Hemisphere, but the global timing, nature and extent of the event are not well established. Evidence in mid to low latitudes of the Southern Hemisphere, in particular, has remained perplexing1, 2, 3, 4, 5, 6. The debate has in part focused on the behaviour of mountain glaciers in New Zealand, where previous research has found equivocal evidence for the precise timing of increased or reduced ice extent1, 2, 3. The interhemispheric behaviour of the climate system during the Younger Dryas thus remains an open question, fundamentally limiting our ability to formulate realistic models of global climate dynamics for this time period. Here we show that New Zealand's glaciers retreated after ~13 kyr bp, at t! he onset of the Younger Dryas, and in general over the subsequent ~1.5-kyr period. Our evidence is based on detailed landform mapping, a high-precision 10Be chronology7 and reconstruction of former ice extents and snow lines from well-preserved cirque moraines. Our late-glacial glacier chronology matches climatic trends in Antarctica, Southern Ocean behaviour and variations in atmospheric CO2. The evidence points to a distinct warming of the southern mid-latitude atmosphere during the Younger Dryas and a close coupling between New Zealand's cryosphere and southern high-latitude climate. These findings support the hypothesis that extensive winter sea ice and curtailed meridional ocean overturning in the North Atlantic led to a strong interhemispheric thermal gradient8 during late-glacial times, in turn leading to increased upwelling and CO2 release from the Southern Ocean9, thereby triggering Southern Hemisphere warming during the northern Younger Dryas. View full text Subject terms: * Earth sciences * Climate science * Geology * Geophysics Figures at a glance * Figure 1: Glacial geomorphology map of the moraines in the Irishman basin, showing locations of sample sites and measured 10Be ages. The map (~1:10,000 scale) differentiates between discrete moraine ridges and areas of more diffuse moraine28. Individual ages are shown in kiloyears with their 1σ analytical errors. Outliers are in non-bold. Systematic uncertainties, such as that associated with the production rate, are minimal when comparing ages of adjacent moraines. Inset maps show location on South Island (top right) and in relation to adjacent major valley systems (top left). * Figure 2: Glacier changes in Irishman basin, New Zealand, in comparison with other climate proxy records. , For the Irishman basin, glacier terminus retreat distance and ELA changes are shown for ~13.0 kyr, ~12 kyr and ~11.5 kyr bp, calculated on the basis of 10Be dating of the moraines (Supplementary Information). Retreat distance is used to show the response of the glacier. We emphasize the pattern of change during the ~1.5-kyr interval for these two parameters. Age uncertainties for the ~13- and ~11.5-kyr moraines include the systematic uncertainties for production rate used, for comparison with other records. , Carbon abundance (percentage carbon) and ratio of lowland podocarp to grass pollen (LPG) from Kaipo bog, North Island19. These proxies indicate the end of the late-glacial reversal and warming early on and through the YDS interval. The age model is based on midpoints of calibrated age ranges19. , δD (deuterium) and CO2 from European Project for Ice Coring in Antarctica (EPICA) Dome C29, 30. The late-glacial ACR interrupted the prominent glacial-to-interglacial ! CO2 increase. , Opal flux from sediment core TN057-13PC9. Spanning the onset of the YDS, between ~13 and ~12 kyr ago, records – show warming in the Southern Hemisphere that matches closely the rise of CO2 concentrations and variations in oceanic upwelling as recorded in the flux of opal. , , δ18O ((18O/16O)sample/(18O/16O)standard − 1 × 1,000, where the standard is standard mean ocean water) from the North Greenland Ice Core Project11 (NGRIP; ) and from the Hulu and Dongge caves, China15 (). Dark- and light-blue shaded regions represent the YDS and ACR cold periods, respectively10, 11, 30. Author information * Author information * Supplementary information * Comments Affiliations * Lamont-Doherty Earth Observatory, Geochemistry, Palisades, New York 10964, USA * Michael R. Kaplan, * Joerg M. Schaefer & * Roseanne Schwartz * Department of Earth and Environmental Sciences, Columbia University, New York, New York 10027, USA * Joerg M. Schaefer * Department of Earth Sciences and Climate Change Institute, University of Maine, Orono, Maine 04469, USA * George H. Denton & * Aaron E. Putnam * GNS Science, Private Bag 1930, Dunedin 9054, New Zealand * David J. A. Barrell * Alpine and Polar Processes Consultancy, Lake Hawea, Otago 9382, New Zealand * Trevor J. H. Chinn * Department of Geosciences, University of Oslo, 0316-Oslo, Norway * Bjørn G. Andersen * Department of Earth and Planetary Sciences, University of California, Berkeley, California 95064, USA * Robert C. Finkel * CEREGE, 13545 Aix-en-Provence, Cedex 4, France * Robert C. Finkel * Antarctic Research Centre and School of Earth Sciences, Victoria University of Wellington, PO Box 600, Wellington 6140, New Zealand * Alice M. Doughty Contributions G.H.D., M.R.K. and J.M.S. instigated this research. M.R.K., J.M.S., R.C.F. and R.S. were responsible for all laboratory efforts, including sample processing, and data interpretation. M.R.K., A.E.P. and A.M.D. participated in field work and designed the field sampling strategies. D.J.A.B., T.J.H.C. and B.G.A. were mainly responsible for the mapping, glacier reconstructions and ELA estimates. All authors contributed to manuscript preparation. Competing financial interests The authors declare no competing financial interests. Corresponding author Correspondence to: * Michael R. Kaplan (mkaplan@ldeo.columbia.edu) Supplementary information * Author information * Supplementary information * Comments PDF files * Supplementary Information (1.7M) This file contains Supplementary Methods, a Supplementary Discussion, Supplementary Tables 1-3, additional references, Supplementary Figures 1- 4 with legends and Supplementary Statistics relating to Supplementary Figure 1 and Figure 1 in the main paper. Additional data - 2010 Maule earthquake slip correlates with pre-seismic locking of Andean subduction zone
- Nature (London) 467(7312):198 (2010)
Nature | Letter 2010 Maule earthquake slip correlates with pre-seismic locking of Andean subduction zone * Marcos Moreno1 Search for this author in: * NPG journals * PubMed * Google Scholar * Matthias Rosenau1 Search for this author in: * NPG journals * PubMed * Google Scholar * Onno Oncken1oncken@gfz-potsdam.de Search for this author in: * NPG journals * PubMed * Google Scholar * Affiliations * Contributions * Corresponding authorJournal name:NatureVolume: 467 ,Pages:198–202Date published:(09 September 2010)DOI:doi:10.1038/nature09349Received12 March 2010Accepted09 July 2010 Article tools * Full text * 日本語要約 * Print * Email * Download PDF * Download citation * Order reprints * Rights and permissions * Share/bookmark * Connotea * CiteULike * Facebook * Twitter * Delicious * Digg The magnitude-8.8 Maule (Chile) earthquake of 27 February 2010 ruptured a segment of the Andean subduction zone megathrust that has been suspected to be of high seismic potential1, 2, 3, 4, 5, 6. It is the largest earthquake to rupture a mature seismic gap in a subduction zone that has been monitored with a dense space-geodetic network before the event. This provides an image of the pre-seismically locked state of the plate interface of unprecedentedly high resolution, allowing for an assessment of the spatial correlation of interseismic locking with coseismic slip. Pre-seismic locking might be used to anticipate future ruptures in many seismic gaps6, 7, 8, 9, 10, 11, 12, given the fundamental assumption that locking and slip are similar. This hypothesis, however, could not be tested without the occurrence of the first gap-filling earthquake. Here we show evidence that the 2010 Maule earthquake slip distribution correlates closely with the patchwork of interseismic locking d! istribution as derived by inversion of global positioning system (GPS) observations during the previous decade. The earthquake nucleated in a region of high locking gradient and released most of the stresses accumulated in the area since the last major event in 1835. Two regions of high seismic slip (asperities) appeared to be nearly fully locked before the earthquake. Between these asperities, the rupture bridged a zone that was creeping interseismically with consistently low coseismic slip. The rupture stopped in areas that were highly locked before the earthquake but where pre-stress had been significantly reduced by overlapping twentieth-century earthquakes. Our work suggests that coseismic slip heterogeneity at the scale of single asperities should indicate the seismic potential of future great earthquakes, which thus might be anticipated by geodetic observations. View full text Subject terms: * Earth sciences * Geology * Geophysics Figures at a glance * Figure 1: Tectonic setting of the study area, data, observations and results. , Shaded relief map of the Andean subduction zone in South-Central Chile. Earthquake segmentation along the margin is indicated by ellipses that enclose the approximate rupture areas of historic earthquakes (updated from refs 4–6). The inset shows the location of panel (rectangle) relative to the South American continent. , Compilation of GPS-observed surface velocities (1996–2008) with respect to stable South America before the 2010 Maule earthquake (for references see online-only Methods). Ellipses attached to the arrows represent 95% confidence limits. , GPS + FEM modelled interface locking (fraction of plate convergence) distribution along the Andean subduction zone megathrust in the decade before the 2010 Maule earthquake. The epicentre (white star, USGS NEIC) and focal mechanism (beach ball, GCMT, http://www.globalcmt.org) of the 2010 Maule earthquake are shown in panels and . * Figure 2: Similarity between coseismic slip and interseismic locking. –, Pre-seismic locking distribution in the study area (isolines) overlaid onto preliminary coseismic slip distributions of the 2010 Maule earthquake. , USGS teleseismic model (ref. 26); , UCSB teleseismic model (ref. 27); , Caltech/JPL teleseismic + GPS model (ref. 28). –, Postseismic slip deficit maps indicating low residuals in the main rupture area present after the 2010 Maule earthquake. Postseismic slip deficit has been calculated as the residuals between 2010 coseismic slip and slip deficit hypothetically accumulated since the last great event in 1835 for each sub-fault element of the coseismic slip distributions. In all panels, the white star and beach ball mark the epicentre (data from USGS NEIC) and focal mechanism (data from GCMT), respectively, and red triangles indicate volcanoes. Residuals in – are based on slip models in –, respectively. * Figure 3: Relationship between pre, co- and postseismic deformation patterns. , Coseismic slip distribution during the 2010 (blue contours; USGS slip model26) and 1960 (green contours; from ref. 30) earthquakes overlain onto pre-seismic locking pattern (red shading ≥0.75), as well as early (during the first 48 h post-shock) M ≥ 5 aftershock locations (the grey circle sizes scale with magnitude; GEOFON data29). , Histograms of early (first 48 h; total number of events, 80) and late (first 3 months; total number of events, 168) aftershock density along a north–south profile (GEOFON data29, M ≥ 5). , Residual slip deficits since 1835 as observed after the 2010 earthquake along a north–south profile (left column, based on the USGS slip model26). The middle and right columns show the effects on slip deficit of overlapping twentieth-century earthquakes (the black lines are polynomial fits to the data). Coloured data points and dates indicate earthquakes by year of occurrence. Author information * Author information * Supplementary information * Comments Affiliations * Helmholtz Centre Potsdam, GFZ German Research Centre for Geosciences, Telegrafenberg, Potsdam 14473, Germany * Marcos Moreno, * Matthias Rosenau & * Onno Oncken Contributions M.M. compiled the GPS data and developed the FEM for data inversion. M.R. analysed the pattern of locking, slip and aftershocks. M.R and M.M. wrote the paper. O.O. was involved in study design and contributed to geodynamic interpretation. All authors discussed the results and commented on the manuscript. Competing financial interests The authors declare no competing financial interests. Corresponding author Correspondence to: * Onno Oncken (oncken@gfz-potsdam.de) Supplementary information * Author information * Supplementary information * Comments PDF files * Supplementary Figures (6.5M) This file contains Supplementary Figures 1-6 with legends. Additional data - A bizarre, humped Carcharodontosauria (Theropoda) from the Lower Cretaceous of Spain
- Nature (London) 467(7312):203 (2010)
Nature | Letter A bizarre, humped Carcharodontosauria (Theropoda) from the Lower Cretaceous of Spain * Francisco Ortega1fortega@ccia.uned.es Search for this author in: * NPG journals * PubMed * Google Scholar * Fernando Escaso1, 2 Search for this author in: * NPG journals * PubMed * Google Scholar * José L. Sanz2 Search for this author in: * NPG journals * PubMed * Google Scholar * Affiliations * Contributions * Corresponding authorJournal name:NatureVolume: 467 ,Pages:203–206Date published:(09 September 2010)DOI:doi:10.1038/nature09181Received07 April 2010Accepted18 May 2010 Article tools * Full text * 日本語要約 * Print * Email * Download PDF * Download citation * Order reprints * Rights and permissions * Share/bookmark * Connotea * CiteULike * Facebook * Twitter * Delicious * Digg Carcharodontosaurs were the largest predatory dinosaurs, and their early evolutionary history seems to be more intricate than was previously thought. Until recently, carcharodontosaurs were restricted to a group of large theropods inhabiting the Late Cretaceous Gondwanan land masses1, 2, but in the last few years Laurasian evidence3, 4, 5 has been causing a reevaluation of their initial diversification6. Here we describe an almost complete and exquisitely preserved skeleton of a medium-sized (roughly six metres long) theropod from the Lower Cretaceous series (Barremian stage) Konservat-Lagerstätte of Las Hoyas7 in Cuenca, Spain. Cladistic analysis supports the idea that the new taxon Concavenator corcovatus is a primitive member of Carcharodontosauria6, exhibiting two unusual features: elongation of the neurapophyses of two presacral vertebrae forming a pointed, hump-like structure and a series of small bumps on the ulna. We think that these bumps are homologous to quill kn! obs present on some modern birds; the knobs are related to the insertion area of follicular ligaments that anchor the roots of the flight feathers (remiges) to the arm. We propose that Concavenator has integumentary follicular structures inserted on the ulna, as in modern birds. Because scales do not have follicles, we consider the structures anchored to the Concavenator arms to be non-scale skin appendages homologous to the feathers of modern birds. If this is true, then the phylogenetic bracket for the presence of non-scale skin structures homologous to feathers in theropod dinosaurs would be extended to the Neotetanurae, enlarging the scope for explaining the origin of feathers in theropods. View full text Subject terms: * Palaeontology * Earth sciences * Evolution Figures at a glance * Figure 1: Holotype of Concavenatorcorcovatus. Specimen MCCM-LH 6666 from the Lower Cretaceous series (Barremian stage) of Las Hoyas (Cuenca, Spain). , Photograph under visible light. , Schematic interpretation of the exposed right side of the skeleton. a, astragalus; aofe, antorbital fenestra; co, coracoid; d11–12sp, neural spines of the eleventh and twelfth dorsal vertebrae; fe, femur; fi, fibula; hu, humerus; il, ilium; is, ischium; j, jugal; l, lacrimal; mt III, third metatarsal; mx, maxilla; na, nasal; po, postorbital; pu, pubis; ra, radius; sc, scapula; ti, tibia; u, ungual phalanx; ul, ulna. * Figure 2: Time-calibrated reduced consensus of the phylogeny of Neotetanurae theropods. , Hypothetical flesh reconstruction of Concavenator corcovatus. , The phylogeny resulting from a parsimony analysis of the data matrix6 in which Concavenator is incorporated (see Supplementary Information). If poorly represented carcharodontosaurian taxa are considered, Concavenator is located either as the sister group to the remaining Carcharodontosauria or as a basal carcharodontosaurian, but on removing the less informative taxa, Concavenator stands unequivocally as the most basal Carcharodontosauridae. Concavenator possesses two unambiguous synapomorphies of Carcharodontosauria: a deeply concave iliac articular surface on the ischia and a proximomedially inclined femoral head. Our analysis agrees with recent hypotheses6 in considering that Carcharodontosauria is basally split into Carcharodontosauridae and Neovenatoridae6. Two cranial synapomorphies would place Concavenator within Carcharodontosauridae: the lacrimal-postorbital contact and a large curving flange in the ! jugal process on the postorbital. Maa, Maastrichtian; Cam, Campanian; San, Santonian; Con, Coniacian; Tur, Turonian; Cen, Cenomanian; Alb, Albian; Apt, Aptian; Bar, Barremian; Hau, Hauterivian; Val, Valanginian; Ber, Berriasian; Tit, Tithonian; Kim, Kimmeridgian; Oxf, Oxfordian; Cal, Callovian; Bat, Bathonian; Baj, Bajocian; Aal, Aalenian. * Figure 3: Details of the holotype of Concavenatorcorcovatus. Specimen MCCM-LH 6666 from the Lower Cretaceous series (Barremian stage) of Las Hoyas (Cuenca, Spain). , Lateral view of the skull. , Middle part of the axial skeleton showing the distribution of the height of the neural spines of vertebrae around the pelvic region. , Detail of distal phalanx of the right foot showing impressions of plantar pads and corneous sheaths of the ungual bones. , Impressions of hexagonal scales associated with the fifth metatarsal. , Distal portion of the tail vertebrae showing a body outline. , Distal portion of the tail vertebrae showing a body outline and the disposition of some rectangular scales. il, ilium; ip, intraorbital process; ob, orbital brow; mt V, fifth metatarsal; sp10–12, neural spines of the tenth–twelfth dorsal vertebrae. * Figure 4: Forearm of Concavenatorcorcovatus. Specimen MCCM-LH 6666 from the Lower Cretaceous series (Barremian stage) of Las Hoyas in Cuenca, Spain. , Forearm (radius and ulna) of Concavenator corcovatus. , Detail of the posterolateral crest showing a series of feather quill knobs (arrows mark the available five elements of the series). , Dorsal view of the ulna of an extant turkey vulture (Cathartes sp.). Scale bars, 1 cm. Author information * Author information * Supplementary information * Comments Affiliations * Grupo de Biología, Departamento de Física Matemática y de Fluidos, Facultad de Ciencias, Universidad Nacional de Educación a Distancia, Paseo Senda del Rey 9, 28040 Madrid, Spain * Francisco Ortega & * Fernando Escaso * Unidad de Paleontología, Departamento de Biología, Facultad de Ciencias, Universidad Autónoma de Madrid, Cantoblanco, 28049 Madrid, Spain * Fernando Escaso & * José L. Sanz Contributions All authors shared all the phases and topics of the work, both in research and in writing the manuscript. F.O. and F.E. were mainly involved in the description and phylogenetical analysis, whereas J.L.S. was mainly involved in the study of the integumentary evidence. All authors discussed the results and implications and commented on the manuscript at all stages. Competing financial interests The authors declare no competing financial interests. Corresponding author Correspondence to: * Francisco Ortega (fortega@ccia.uned.es) Supplementary information * Author information * Supplementary information * Comments PDF files * Supplementary Information (1.1M) This file contains Supplementary Information comprising Scores for Concavenator corcovatus, Phylogenetic analysis, Selected measurements for appendicular elements of the holotype specimen, additional references, Supplementary Figures 1-5 with legends and Supplementary Pictures 1-5 with legends. Additional data - Whole-exome sequencing identifies recessive WDR62 mutations in severe brain malformations
Bilgüvar K Oztürk AK Louvi A Kwan KY Choi M Tatlı B Yalnızoğlu D Tüysüz B Cağlayan AO Gökben S Kaymakçalan H Barak T Bakırcıoğlu M Yasuno K Ho W Sanders S Zhu Y Yılmaz S Dinçer A Johnson MH Bronen RA Koçer N Per H Mane S Pamir MN Yalçınkaya C Kumandaş S Topçu M Ozmen M Sestan N Lifton RP State MW Günel M - Nature (London) 467(7312):207 (2010)
Nature | Letter Whole-exome sequencing identifies recessive WDR62 mutations in severe brain malformations * Kaya Bilgüvar1, 2, 3, 22 Search for this author in: * NPG journals * PubMed * Google Scholar * Ali Kemal Öztürk1, 2, 3, 22 Search for this author in: * NPG journals * PubMed * Google Scholar * Angeliki Louvi1, 2, 3 Search for this author in: * NPG journals * PubMed * Google Scholar * Kenneth Y. Kwan2, 4 Search for this author in: * NPG journals * PubMed * Google Scholar * Murim Choi3 Search for this author in: * NPG journals * PubMed * Google Scholar * Burak Tatlı5 Search for this author in: * NPG journals * PubMed * Google Scholar * Dilek Yalnızoğlu6 Search for this author in: * NPG journals * PubMed * Google Scholar * Beyhan Tüysüz7 Search for this author in: * NPG journals * PubMed * Google Scholar * Ahmet Okay Çağlayan8 Search for this author in: * NPG journals * PubMed * Google Scholar * Sarenur Gökben9 Search for this author in: * NPG journals * PubMed * Google Scholar * Hande Kaymakçalan10 Search for this author in: * NPG journals * PubMed * Google Scholar * Tanyeri Barak1, 2, 3 Search for this author in: * NPG journals * PubMed * Google Scholar * Mehmet Bakırcıoğlu1, 2, 3 Search for this author in: * NPG journals * PubMed * Google Scholar * Katsuhito Yasuno1, 2, 3 Search for this author in: * NPG journals * PubMed * Google Scholar * Winson Ho1, 2, 3 Search for this author in: * NPG journals * PubMed * Google Scholar * Stephan Sanders3, 11, 12 Search for this author in: * NPG journals * PubMed * Google Scholar * Ying Zhu2, 4 Search for this author in: * NPG journals * PubMed * Google Scholar * Sanem Yılmaz9 Search for this author in: * NPG journals * PubMed * Google Scholar * Alp Dinçer13 Search for this author in: * NPG journals * PubMed * Google Scholar * Michele H. Johnson1, 14, 15 Search for this author in: * NPG journals * PubMed * Google Scholar * Richard A. Bronen1, 14 Search for this author in: * NPG journals * PubMed * Google Scholar * Naci Koçer16 Search for this author in: * NPG journals * PubMed * Google Scholar * Hüseyin Per17 Search for this author in: * NPG journals * PubMed * Google Scholar * Shrikant Mane3, 18 Search for this author in: * NPG journals * PubMed * Google Scholar * Mehmet Necmettin Pamir19 Search for this author in: * NPG journals * PubMed * Google Scholar * Cengiz Yalçınkaya20 Search for this author in: * NPG journals * PubMed * Google Scholar * Sefer Kumandaş17 Search for this author in: * NPG journals * PubMed * Google Scholar * Meral Topçu6 Search for this author in: * NPG journals * PubMed * Google Scholar * Meral Özmen5 Search for this author in: * NPG journals * PubMed * Google Scholar * Nenad Šestan2, 4 Search for this author in: * NPG journals * PubMed * Google Scholar * Richard P. Lifton3, 21richard.lifton@yale.edu Search for this author in: * NPG journals * PubMed * Google Scholar * Matthew W. State3, 11, 12matthew.state@yale.edu Search for this author in: * NPG journals * PubMed * Google Scholar * Murat Günel1, 2, 3murat.gunel@yale.edu Search for this author in: * NPG journals * PubMed * Google Scholar * Affiliations * Contributions * Corresponding authorsJournal name:NatureVolume: 467 ,Pages:207–210Date published:(09 September 2010)DOI:doi:10.1038/nature09327Received11 May 2010Accepted30 June 2010Published online22 August 2010 Article tools * Full text * 日本語要約 * Print * Email * Download PDF * Download citation * Order reprints * Rights and permissions * Share/bookmark * Connotea * CiteULike * Facebook * Twitter * Delicious * Digg The development of the human cerebral cortex is an orchestrated process involving the generation of neural progenitors in the periventricular germinal zones, cell proliferation characterized by symmetric and asymmetric mitoses, followed by migration of post-mitotic neurons to their final destinations in six highly ordered, functionally specialized layers1, 2. An understanding of the molecular mechanisms guiding these intricate processes is in its infancy, substantially driven by the discovery of rare mutations that cause malformations of cortical development3, 4, 5, 6. Mapping of disease loci in putative Mendelian forms of malformations of cortical development has been hindered by marked locus heterogeneity, small kindred sizes and diagnostic classifications that may not reflect molecular pathogenesis. Here we demonstrate the use of whole-exome sequencing to overcome these obstacles by identifying recessive mutations in WD repeat domain 62 (WDR62) as the cause of a wide spec! trum of severe cerebral cortical malformations including microcephaly, pachygyria with cortical thickening as well as hypoplasia of the corpus callosum. Some patients with mutations in WDR62 had evidence of additional abnormalities including lissencephaly, schizencephaly, polymicrogyria and, in one instance, cerebellar hypoplasia, all traits traditionally regarded as distinct entities. In mice and humans, WDR62 transcripts and protein are enriched in neural progenitors within the ventricular and subventricular zones. Expression of WDR62 in the neocortex is transient, spanning the period of embryonic neurogenesis. Unlike other known microcephaly genes, WDR62 does not apparently associate with centrosomes and is predominantly nuclear in localization. These findings unify previously disparate aspects of cerebral cortical development and highlight the use of whole-exome sequencing to identify disease loci in settings in which traditional methods have proved challenging. View full text Subject terms: * Genetics * Genomics * Medical research * Neuroscience * Developmental biology Figures at a glance * Figure 1: Identification of a 4-bp deletion in the WDR62 gene in a family with microcephaly and pachygyria. –, Coronal () and axial () magnetic resonance images of a control subject compared with NG 26-1 (, ) confirms the clinical diagnosis of microcephaly and shows a diffusely thickened cortex, an indistinct grey–white junction, pachgyria and underoperculization. All images are T2 weighted (photographically inverted). Scale bars, centimetres. , A 4-bp deletion (red box) in the WDR62 is identified through exome sequencing (WT, wild type). , Sanger sequencing confirms the deleted bases (in green). The altered amino-acid sequence (starting at position 1,402) leading to a premature stop-codon (X) is shown in red. * Figure 2: Additional WDR62 mutations. –, Pedigree structures with mutated bases (red) and the corresponding normal alleles (green) are marked on the chromatograms (left, mutant; right, wild type). , Families NG 26 and NG 891 harbour the identical 4-bp deletion, whereas nonsense mutations leading to premature stop codons (X) are observed in NG 30 () and NG 294 (). Missense mutations affecting conserved amino acids are seen in NG 190 () and NG 537 (). In NG 339 (), a 17-bp deletion leads to a premature stop codon. , The locations of independent mutations are indicated on the genomic organization of WDR62. * Figure 3: Representative magnetic resonance images from patients demonstrating the wide spectrum of findings associated with mutations in WDR62. , , , , Axial (), coronal (), sagittal () MRI images and three-dimensional surface rendering () of a control subject are shown. , Microlissencephalic features with microcephaly, diffusely thickened cortex, loss of grey–white junction and pachygyria. , Asymmetric microcephalic hemispheres with marked polymicrogyria (arrowheads). , Significant polymicrogyria (black arrowheads) and open-lip schizencephaly (red arrowhead). , Unilateral cerebellar hypoplasia (arrowhead). , Open-lip schizencephaly (red arrowhead) and the polymicrogyric cortex. , Unilateral brainstem atrophy (arrow). , Three-dimensional surface rendering demonstrating craniofacial dysmorphology. , Microcephaly, pachygyria and abnormally shaped corpus callosum (arrowheads). * Figure 4: Wdr62 expression in the developing mouse brain. , Wdr62 expression is enriched in the ventricular and subventricular zones (VZ and SVZ, respectively) as seen with in situ hybridization. , WDR62 protein (red) distribution reveals a similar pattern. CP, cortical plate. , , WDR62 (red) localizes to the nuclei and is expressed by neural stem cells and intermediate progenitors, as marked by SOX2 and TBR2 expression (green), respectively. , Immunofluorescent staining for α-tubulin (cytoplasmic, blue), SOX2 (nuclear, green) and WDR62 (red) in E12.5 cortical neural progenitor cells reveals that the distribution of the WDR62 overlaps with that of SOX2 and is predominantly nuclear. (Nuclear staining by 4′,6-diamidino-2-phenylindole (DAPI) (blue) in –; rightmost panels are composite images in –). Author information * Author information * Supplementary information * Comments Primary authors * These authors contributed equally to this work. * Kaya Bilgüvar & * Ali Kemal Öztürk Affiliations * Department of Neurosurgery, Yale University School of Medicine, New Haven, Connecticut 06510, USA * Kaya Bilgüvar, * Ali Kemal Öztürk, * Angeliki Louvi, * Tanyeri Barak, * Mehmet Bakırcıoğlu, * Katsuhito Yasuno, * Winson Ho, * Michele H. Johnson, * Richard A. Bronen & * Murat Günel * Department of Neurobiology, Yale University School of Medicine, New Haven, Connecticut 06510, USA * Kaya Bilgüvar, * Ali Kemal Öztürk, * Angeliki Louvi, * Kenneth Y. Kwan, * Tanyeri Barak, * Mehmet Bakırcıoğlu, * Katsuhito Yasuno, * Winson Ho, * Ying Zhu, * Nenad Šestan & * Murat Günel * Department of Genetics, Center for Human Genetics and Genomics and Program on Neurogenetics, Yale University School of Medicine, New Haven, Connecticut 06510, USA * Kaya Bilgüvar, * Ali Kemal Öztürk, * Angeliki Louvi, * Murim Choi, * Tanyeri Barak, * Mehmet Bakırcıoğlu, * Katsuhito Yasuno, * Winson Ho, * Stephan Sanders, * Shrikant Mane, * Richard P. Lifton, * Matthew W. State & * Murat Günel * Kavli Institute for Neuroscience, Yale University School of Medicine, New Haven, Connecticut 06510, USA * Kenneth Y. Kwan, * Ying Zhu & * Nenad Šestan * Division of Neurology, Department of Pediatrics, Istanbul University Istanbul Medical Faculty, Istanbul 34093, Turkey * Burak Tatlı & * Meral Özmen * Division of Neurology, Department of Pediatrics, Hacettepe University School of Medicine, Sihhiye, Ankara 06100, Turkey * Dilek Yalnızoğlu & * Meral Topçu * Division of Genetics, Department of Pediatrics, Istanbul University Cerrahpasa Faculty of Medicine, Istanbul 34098, Turkey * Beyhan Tüysüz * Department of Medical Genetics, Kayseri Education and Research Hospital, Kayseri 38010, Turkey * Ahmet Okay Çağlayan * Division of Neurology, Department of Pediatrics, Ege University Faculty of Medicine, Izmir 35100, Turkey * Sarenur Gökben & * Sanem Yılmaz * Faculty of Arts and Sciences, Bahcesehir University, Istanbul 34353, Turkey * Hande Kaymakçalan * Department of Psychiatry, Yale University School of Medicine, New Haven, Connecticut 06510, USA * Stephan Sanders & * Matthew W. State * Child Study Center, Yale University School of Medicine, New Haven, Connecticut 06510, USA * Stephan Sanders & * Matthew W. State * Department of Radiology, Acibadem University School of Medicine, Istanbul 34742, Turkey * Alp Dinçer * Department of Radiology, Yale University School of Medicine, New Haven, Connecticut 06510, USA * Michele H. Johnson & * Richard A. Bronen * Department of Otolaryngology, Yale University School of Medicine, New Haven, Connecticut 06510, USA * Michele H. Johnson * Department of Radiology, Istanbul University Cerrahpasa Faculty of Medicine, Istanbul 34098, Turkey * Naci Koçer * Division of Neurology, Department of Pediatrics, Erciyes University School of Medicine, Kayseri 38039, Turkey * Hüseyin Per & * Sefer Kumandaş * Yale Center for Genome Analysis, Yale University School of Medicine, New Haven, Connecticut 06510, USA * Shrikant Mane * Department of Neurosurgery, Acibadem University School of Medicine, Istanbul 34742, Turkey * Mehmet Necmettin Pamir * Division of Child Neurology, Department of Neurology, Istanbul University Cerrahpasa Faculty of Medicine, Istanbul 34098, Turkey * Cengiz Yalçınkaya * Howard Hughes Medical Institute, Yale University School of Medicine, New Haven, Connecticut 06510, USA * Richard P. Lifton Contributions M.W.S., R.P.L. and M.G. designed the study and K.B., A.L., N.S., R.P.L. and M.G. designed the experiments. K.B., A.K.O., A.L., K.Y.K., T.B., M.B., S.S., W.H. and S.M. performed the experiments. B.T., D.Y., B.T., A.O.C., S.G., H.K., S.Y., H.P., C.Y., S.K., M.T. and M.O. identified, consented and recruited the study subjects and provided clinical information. A.D., M.H.J., R.A.B., N.K. and M.N.P. performed and evaluated magnetic resonance imaging. M.C. and R.P.L. developed the bioinformatics scripts for data analysis. K.B., A.K.O., K.Y., A.L. and M.G. analysed the genetics data. A.L., K.Y.K, Y.Z., N.S. and M.G. analysed the expression data. K.B., A.K.O, A.L., R.P.L., M.W.S. and M.G. wrote the paper. Competing financial interests The authors have a provisional patent application under consideration based on the findings of this work. R.A.B. is a consultant for Bristol-Myers Squibb. Corresponding authors Correspondence to: * Richard P. Lifton (richard.lifton@yale.edu) or * Matthew W. State (matthew.state@yale.edu) or * Murat Günel (murat.gunel@yale.edu) Supplementary information * Author information * Supplementary information * Comments Movies * Supplementary Movie 1 (3.9M) This video is constructed from T2 sagittal images (photographically inverted) of patient NG 26-1 and demonstrates microcephaly and cortical thickening (see Supplementary Information file for full legend). * Supplementary Movie 2 (3.5M) This video is constructed from T2 coronal images (photographically inverted) of patient NG 26-1 and demonstrates microcephaly and cortical thickening (see Supplementary Information file for full legend). * Supplementary Movie 3 (3.8M) This video is constructed from T2 sagittal images of patient NG 190-1 (photographically inverted) and it shows diffuse cortical volume loss and marked craniofacial disproportion (see Supplementary Information file for full legend). * Supplementary Movie 4 (3.5M) This video is constructed from T2 coronal images of patient NG 190-1 (photographically inverted) and it shows diffuse cortical volume loss and marked craniofacial disproportion (see Supplementary Information file for full legend). * Supplementary Movie 5 (716K) This video is constructed from T1 sagittal images (photographically inverted) of patient NG 891-1 and it demonstrates radiographic findings consistent with microlissencephaly including prominent microcephaly (see Supplementary Information file for full legend). * Supplementary Movie 6 (119K) This video is constructed from T1 coronal images (photographically inverted) of patient NG 891-1 and it demonstrates radiographic findings consistent with microlissencephaly including prominent microcephaly (see Supplementary Information file for full legend). PDF files * Supplementary Information (2M) This file contains Supplementary Patient Notes, legends for Supplementary Videos 1- 6 (see separate Movie files 1-6), Supplementary Figures 1-8 with legends and Supplementary Tables 1-6. Additional data - Production of p53 gene knockout rats by homologous recombination in embryonic stem cells
Tong C Li P Wu NL Yan Y Ying QL - Nature (London) 467(7312):211 (2010)
Nature | Letter Production of p53 gene knockout rats by homologous recombination in embryonic stem cells * Chang Tong1 Search for this author in: * NPG journals * PubMed * Google Scholar * Ping Li1, 3 Search for this author in: * NPG journals * PubMed * Google Scholar * Nancy L. Wu2 Search for this author in: * NPG journals * PubMed * Google Scholar * Youzhen Yan2 Search for this author in: * NPG journals * PubMed * Google Scholar * Qi-Long Ying1qying@usc.edu Search for this author in: * NPG journals * PubMed * Google Scholar * Affiliations * Contributions * Corresponding authorJournal name:NatureVolume: 467 ,Pages:211–213Date published:(09 September 2010)DOI:doi:10.1038/nature09368Received11 May 2010Accepted26 July 2010Published online11 August 2010 Article tools * Full text * 日本語要約 * Print * Email * Download PDF * Download citation * Order reprints * Rights and permissions * Share/bookmark * Connotea * CiteULike * Facebook * Twitter * Delicious * Digg The use of homologous recombination to modify genes in embryonic stem (ES) cells provides a powerful means to elucidate gene function and create disease models1. Application of this technology to engineer genes in rats has not previously been possible because of the absence of germline-competent ES cells in this species. We have recently established authentic rat ES cells2, 3. Here we report the generation of gene knockout rats using the ES-cell-based gene targeting technology. We designed a targeting vector to disrupt the tumour suppressor gene p53 (also known as Tp53) in rat ES cells by means of homologous recombination. p53 gene-targeted rat ES cells can be routinely generated. Furthermore, the p53 gene-targeted mutation in the rat ES-cell genome can transmit through the germ line via ES-cell rat chimaeras to create p53 gene knockout rats. The rat is the most widely used animal model in biological research4, 5, 6, 7. The establishment of gene targeting technology in rat E! S cells, in combination with advances in genomics and the vast amount of research data on physiology and pharmacology in this species, now provide a powerful new platform for the study of human disease. View full text Subject terms: * Stem cells * Developmental biology * Genetics * Genomics Figures at a glance * Figure 1: Schematic diagram showing the strategy to disrupt the rat p53 gene via homologous recombination. , Structures of the wild-type (WT) rat p53 allele and the rat p53 gene-targeting vector. H, HindIII; S, SpeI; black squares indicate exons. , The predicted structure of the gene-targeted rat p53tm1(EGFP-pac) allele. * Figure 2: Confirmation of p53 gene targeting in rat ES cells. , Phase-contrast and fluorescence images of DAc8-p53-1 rat ES cells. Scale bar, 50 μm. , Southern blot analysis of p53 gene-targeted rat ES cells using 5′, 3′ or internal probes. For Southern blot analysis with 5′ or internal probes, genomic DNA from rat ES cells was digested with SpeI. For Southern blot analysis using 3′ probe, rat ES-cell genomic DNA was digested with HindIII. The expected sizes of wild-type and p53 gene-targeted bands with different probes are shown in Fig. 1. , Diagram showing the positions of two PCR primer pairs. –, Sequence alignment of PCR products amplified from DAc8-p53-1 rat ES cells. The sequence of the PCR product (Query) amplified using the first pair of primers (F1 and R1) was aligned with the sequences of the rat genome () or the p53 gene-targeting vector (). The sequence of the PCR product amplified using the second pair of primers (F2 and R2) was aligned with the sequences of the p53 gene-targeting vector () or the rat genome (! ). The highlighted sequences represent the junctions between the homology arms and the rat genome ( and ) or the CAG-EGFP-IRES-Pac cassette ( and ). * Figure 3: Germline transmission of the p53 gene-targeted mutation in the rat. , The male chimaera generated from the DAc8-p53-1 subclone. The agouti coat colour and the appearance of GFP-positive tissues indicate that p53 gene-targeted DAc8 rat cells were present in the ES-cell rat chimaera. , Offspring produced by breeding the male chimaera shown in with Sprague–Dawley female rats. , Diagrams showing the positions of three PCR primers designed for genotyping p53 gene-targeted offspring. F1, GCGTTGCTCTGATGGTGAC; F2, TGCGGTGGGCTCTATGGCTTCT; R, CAGCGTGATGATGGTAAGGAT. The expected sizes of PCR products for wild-type and p53 gene-targeted alleles are 309 bp and 498 bp, respectively. , PCR genotyping analysis of the p53 gene-targeted allele. M, 100 bp DNA marker; 1, DAc8 rat ES cells; 2, DAc8-p53-1 rat ES cells; 3, 6 and 8, the three GFP-negative germline offspring; 4, 5 and 7, the three GFP-positive offspring; 9 and 10, the two albino littermates. , Southern blot analysis for the p53 gene-targeted allele using the 5′ probe. 1, 4 and 6 are the th! ree GFP-negative germline offspring; 2, 3 and 5 are the three GFP-positive offspring. * Figure 4: Generation of p53 gene knockout rats. , Offspring generated by intercrossing p53tm1(EGFP-pac) heterozygote rats. , Genotyping analysis on tail biopsies using PCR primers shown in Fig. 3c. M, 100 bp DNA marker; 1–9, the nine GFP-positive offspring; 3 and 7, the two p53tm1(EGFP-pac) homozygote pups; 10–12, the three GFP-negative offspring. , Detection of p53 mRNA by northern blot analysis. Northern blot analysis was performed by sequential hybridization with probes for p53 and β-actin. , Detection of p53 protein by western blot analysis. Author information * Author information * Supplementary information * Comments Affiliations * Eli and Edythe Broad Center for Regenerative Medicine and Stem Cell Research at USC, Department of Cell and Neurobiology, Keck School of Medicine, University of Southern California, Los Angeles, California 90033, USA * Chang Tong, * Ping Li & * Qi-Long Ying * USC/Norris Cancer Center Transgenic/Knockout Core Facility, Keck School of Medicine, University of Southern California, Los Angeles, California 90033, USA * Nancy L. Wu & * Youzhen Yan * Present address: Key Laboratory of Molecular Medicine, Ministry of Education, Fudan University, Shanghai 200032, China. * Ping Li Contributions C.T. designed and performed most of the experiments described in the paper. P.L. and Q.-L.Y. derived and cultured rat ES cells. N.L.W. and Y.Y. performed blastocyst injections. Q.-L.Y. conceived the study and wrote the paper. Competing financial interests Q.L.Y. is an inventor on a patent relating to this study filed by the University of Edinburgh and licensed to StemCells Inc. Corresponding author Correspondence to: * Qi-Long Ying (qying@usc.edu) The p53 gene-targeted rats generated in this study will be deposited in the Rat Resource and Research Center at University of Missouri. Supplementary information * Author information * Supplementary information * Comments PDF files * Supplementary Information (371K) This file contains Supplementary Table 1 and Supplementary Figures 1-5. Additional data - A cryptic sensor for HIV-1 activates antiviral innate immunity in dendritic cells
- Nature (London) 467(7312):214 (2010)
Nature | Letter A cryptic sensor for HIV-1 activates antiviral innate immunity in dendritic cells * Nicolas Manel1, 2 Search for this author in: * NPG journals * PubMed * Google Scholar * Brandon Hogstad1, 3 Search for this author in: * NPG journals * PubMed * Google Scholar * Yaming Wang4 Search for this author in: * NPG journals * PubMed * Google Scholar * David E. Levy4 Search for this author in: * NPG journals * PubMed * Google Scholar * Derya Unutmaz5 Search for this author in: * NPG journals * PubMed * Google Scholar * Dan R. Littman1, 3, 5dan.littman@med.nyu.edu Search for this author in: * NPG journals * PubMed * Google Scholar * Affiliations * Contributions * Corresponding authorJournal name:NatureVolume: 467 ,Pages:214–217Date published:(09 September 2010)DOI:doi:10.1038/nature09337Received27 May 2010Accepted06 July 2010 Article tools * Full text * 日本語要約 * Print * Email * Download PDF * Download citation * Order reprints * Rights and permissions * Share/bookmark * Connotea * CiteULike * Facebook * Twitter * Delicious * Digg Dendritic cells serve a key function in host defence, linking innate detection of microbes to activation of pathogen-specific adaptive immune responses1, 2. Whether there is cell-intrinsic recognition of human immunodeficiency virus (HIV) by host innate pattern-recognition receptors and subsequent coupling to antiviral T-cell responses is not yet known3. Dendritic cells are largely resistant to infection with HIV-14, but facilitate infection of co-cultured T-helper cells through a process of trans-enhancement5, 6. Here we show that, when dendritic cell resistance to infection is circumvented7, 8, HIV-1 induces dendritic cell maturation, an antiviral type I interferon response and activation of T cells. This innate response is dependent on the interaction of newly synthesized HIV-1 capsid with cellular cyclophilin A (CYPA) and the subsequent activation of the transcription factor IRF3. Because the peptidylprolyl isomerase CYPA also interacts with HIV-1 capsid to promote infec! tivity, our results indicate that capsid conformation has evolved under opposing selective pressures for infectivity versus furtiveness. Thus, a cell-intrinsic sensor for HIV-1 exists in dendritic cells and mediates an antiviral immune response, but it is not typically engaged owing to the absence of dendritic cell infection. The virulence of HIV-1 may be related to evasion of this response, the manipulation of which may be necessary to generate an effective HIV-1 vaccine. View full text Subject terms: * Immunology * Cell biology * Virology * Medical research Figures at a glance * Figure 1: Productive infection of MDDC with HIV-1 induces a type I IFN response. , GFP expression and CD86 surface expression in MDDCs at 48 h after infection with HIV-GFP(G) and SIV-VLP(G), alone or in combination. , Immunoblot of phospho-STAT1 and total actin expression over time in MDDCs infected with HIV-GFP(G) and SIV-VLP(G) or treated with LPS. , Type I IFN activity in the supernatant of MDDCs or activated CD4+ T cells infected with dilutions of HIV-GFP(G) with SIV-VLP(G) or with Sendai virus (SeV). , Type I IFN activity in supernatants of MDDCs, 293FT and THP-1 cells infected with dilutions of HIV-GFP(G) with or without SIV-VLP(G) or transfected with poly(I:C) or RNA from Newcastle disease virus (NDV)-infected cells using lipofectamine (lipo). * Figure 2: Dendritic cell activation requires CYPA interaction with newly synthesized HIV-1 capsid. , GFP and CD86 expression in MDDCs infected with HIV-GFP(G) or its mutants, ΔRev, ΔGag or PTAP− in the presence of SIV-VLP(G). HIV-GFP was rescued in all cases by co-expression of wild-type proteins in packaging cells. , Effect of HIV-1 capsid mutations on the proportion of GFP+-infected MDDCs that express CD86. MDDCs were infected with serially diluted wild-type (WT) (pLaiΔEnv-GFP3(G)) or HIV-1 capsid mutants (T54A/N57A, Q63A/Q67A or G89V), in the presence of SIV-VLP(G). HIV-1 capsid mutant infectivity was rescued by co-expression of wild-type proteins in packaging cells. *P < 0.026 (n = 9). , Effect of cyclosporin A and FK506 on expression of CD86 in MDDCs infected with HIV-GFP(G) and SIV-VLP(G) or after treatment with LPS. Cyclosporin A and FK506 target the calcineurin pathway but FK506 does not bind to CYPA. , Expression of GFP, RFP and CD86 in HIV-infected cells after CYPA knockdown by RNAi. MDDCs were transduced with GFP-encoding control shRNA vector or a shRN! A vector targeting CYPA, in the presence of SIV-VLP(G), and subsequently challenged with HDV-IRES-RFP(G) or treated with LPS. Right, cells are gated on GFP+ populations shown on the left. Experiments were performed on a total of at least six donors, except , which was performed on four donors. * Figure 3: Dendritic cell activation by HIV-1 requires IRF3. , Tubulin, histone H3, IRF3 and phospho-Ser396-IRF3 expression in cytoplasmic and nuclear fractions of MDDCs infected with SIV-VLP(G) and dilutions of HIV-GFP(G) in the presence or the absence of cyclosporin A. Cells were harvested 8 h after infection or after control treatment with poly(I:C). , GFP, RFP and CD86 expression in MDDCs initially transduced with GFP-encoding-control shRNA vector or a shRNA vector targeting IRF3, and subsequently challenged with HDV-IRES-RFP(G) or treated with poly(I:C) or curdlan. Right, cells are gated on GFP+ transduced populations. * Figure 4: Activation of T cells and inhibition of trans-enhancement by MDDCs productively infected with HIV-1. , GFP and CD86 expression in control and HIV-1-infected dendritic cells (top) and carboxyfluorescein succinimidyl ester (CFSE) dilution (bottom) in CFSE-labelled naive CD4+ T cells cultured with the dendritic cells for 4 days in the presence of anti-CD3 antibody. , GFP and CD86 expression in dendritic cells (top) and CFSE dilution (bottom) in naive CD4+ T cells cultured for 4 days with untreated dendritic cells or dendritic cells treated with 25 µM AZT or 1 µM SCY after infection. , Induction of a type-I-IFN-dependent antiviral state inhibits MDDC-dependent trans-enhancement. MDDCs were infected with dilutions of HDV-IRES-RFP(G) with or without SIV-VLP(G) in the presence or absence of type-I-IFN-neutralizing reagents. Activated CD4+ T cells and a CCR5-tropic HIV-1-GFP (R5–GFP) were added 2 days later. RFP and CD86 expression and GFP expression were measured in dendritic cells and CD4+ T cells, respectively. Trans-enhancement is indicated by the increase in GFP+ T cel! ls in the presence or absence of MDDCs in the top panel (error bars indicate standard error of the mean for three independent donors). Accession codes * Accession codes * Author information * Supplementary information * Comments Primary accessions Gene Expression Omnibus * GSE22589 Author information * Accession codes * Author information * Supplementary information * Comments Affiliations * Molecular Pathogenesis Program, The Kimmel Center for Biology and Medicine of the Skirball Institute, New York University School of Medicine, New York, New York 10016, USA * Nicolas Manel, * Brandon Hogstad & * Dan R. Littman * CNRS-UMR5535, Institut de Génétique Moléculaire de Montpellier, Université Montpellier I and II, 34070 Montpellier, France * Nicolas Manel * Howard Hughes Medical Institute, New York University School of Medicine, New York, New York 10016, USA * Brandon Hogstad & * Dan R. Littman * Department of Pathology and New York University Cancer Institute, New York University School of Medicine, New York, New York 10016, USA * Yaming Wang & * David E. Levy * Departments of Microbiology and Pathology, New York University School of Medicine, New York, New York 10016, USA * Derya Unutmaz & * Dan R. Littman Contributions N.M. and D.R.L. designed the study and wrote the manuscript. N.M. performed the experiments and analyses. B.H. provided technical help. D.U. provided expertise and contributed to experiments with human T-cell proliferation assays. D.E.L. provided expertise in identifying the IFN response. D.E.L. and Y.W. designed the quantitative bioassay for IFNs and Y.W. performed the assay. All authors discussed results and edited the manuscript. Competing financial interests The authors declare no competing financial interests. Corresponding author Correspondence to: * Dan R. Littman (dan.littman@med.nyu.edu) Microarray data has been deposited in the NCBI GEO database under the accession number GSE22589. Supplementary information * Accession codes * Author information * Supplementary information * Comments PDF files * Supplementary Information (2M) This file contains Supplementary Tables 1- 4 and Supplementary Figures 1 – 18 with legends. Additional data - MEC-17 is an α-tubulin acetyltransferase
- Nature (London) 467(7312):218 (2010)
Nature | Letter MEC-17 is an α-tubulin acetyltransferase * Jyothi S. Akella1, 3 Search for this author in: * NPG journals * PubMed * Google Scholar * Dorota Wloga1, 3 Search for this author in: * NPG journals * PubMed * Google Scholar * Jihyun Kim1 Search for this author in: * NPG journals * PubMed * Google Scholar * Natalia G. Starostina1 Search for this author in: * NPG journals * PubMed * Google Scholar * Sally Lyons-Abbott2 Search for this author in: * NPG journals * PubMed * Google Scholar * Naomi S. Morrissette2 Search for this author in: * NPG journals * PubMed * Google Scholar * Scott T. Dougan1 Search for this author in: * NPG journals * PubMed * Google Scholar * Edward T. Kipreos1 Search for this author in: * NPG journals * PubMed * Google Scholar * Jacek Gaertig1jgaertig@cb.uga.edu Search for this author in: * NPG journals * PubMed * Google Scholar * Affiliations * Contributions * Corresponding authorJournal name:NatureVolume: 467 ,Pages:218–222Date published:(09 September 2010)DOI:doi:10.1038/nature09324Received08 July 2009Accepted30 June 2010 Article tools * Full text * 日本語要約 * Print * Email * Download PDF * Download citation * Order reprints * Rights and permissions * Share/bookmark * Connotea * CiteULike * Facebook * Twitter * Delicious * Digg In most eukaryotic cells, subsets of microtubules are adapted for specific functions by post-translational modifications (PTMs) of tubulin subunits. Acetylation of the ε-amino group of K40 on α-tubulin is a conserved PTM on the luminal side of microtubules1 that was discovered in the flagella of Chlamydomonas reinhardtii2, 3. Studies on the significance of microtubule acetylation have been limited by the undefined status of the α-tubulin acetyltransferase. Here we show that MEC-17, a protein related to the Gcn5 histone acetyltransferases4 and required for the function of touch receptor neurons in Caenorhabditis elegans5, 6, acts as a K40-specific acetyltransferase for α-tubulin. In vitro, MEC-17 exclusively acetylates K40 of α-tubulin. Disruption of the Tetrahymena MEC-17 gene phenocopies the K40R α-tubulin mutation and makes microtubules more labile. Depletion of MEC-17 in zebrafish produces phenotypes consistent with neuromuscular defects. In C. elegans, MEC-17 and i! ts paralogue W06B11.1 are redundantly required for acetylation of MEC-12 α-tubulin, and contribute to the function of touch receptor neurons partly via MEC-12 acetylation and partly via another function, possibly by acetylating another protein. In summary, we identify MEC-17 as an enzyme that acetylates the K40 residue of α-tubulin, the only PTM known to occur on the luminal surface of microtubules. View full text Subject terms: * Cell biology * Neuroscience Figures at a glance * Figure 1: MEC-17 is required for acetylation of K40 on α-tubulin in Tetrahymena. –, Wild-type (pre-fed with ink) and MEC17-KO (arrow) cells labelled with anti-acetyl-K40 mAb (6-11B-1) and anti-tubulin antibodies. –, Wild-type (), MEC17-KO () and K40R () Tetrahymena labelled with pan anti-acetyl-K antibodies. –, Western blots of cells () or cytoskeletons () probed with 6-11B-1 mAb, pan anti-acetyl-K, anti-α-tubulin (12G10 mAb) and anti-histone hv1 antibodies. Stars mark non-tubulin proteins. Arrows mark acetylated histones. , Growth curves of Tetrahymena. –, Wild-type (left) and GFP–Mec17p overproducing (right) Tetrahymena cells analysed for GFP () or 6-11B-1 mAb immunofluorescence (). Merged image is shown in . * Figure 2: MEC-17 and W06B11.1 are required for acetylation of K40 and contribute to touch sensation in C. elegans. –, Wild-type and mutant adult hermaphrodites were labelled using 6-11B-1 mAb. Small and large arrows mark axons and cell bodies of TRNs, respectively. Scale bar, 10 μm. , Histogram quantifying touch responses. The error bars represent s.e.m. Asterisk marks significant difference when compared to K40 transgene mec-12(e1607) (P < 0.0001). The following numbers of animals were tested: wild type, 69; mec-12(e1607), 49; mec-17(ok2109), 44; W06B11.1(ok2415), 33; mec-17(ok2109) W06B11.1(ok2415), 140; K40 transgene mec-12(e1607), 84; Q40 transgene mec-12(e1607), 78; R40 transgene mec12(e1607), 75. * Figure 3: MEC-17 is required for K40 acetylation in zebrafish and normal embryonic development. Control embryos (, , , , ) and embryos injected with ATG-MEC17 morpholinos, 48 h.p.f. (, , , , ) were observed live (, ) or subjected to immunofluorescence 48 h.p.f. using either 6-11B-1 mAb (–) or Znp1 mAb (, ), which recognizes synaptotagmin 1. and show higher magnifications of the areas boxed in and . and show higher magnifications of the areas of pronephrons that contain cilia (marked with arrows in and ). In and , arrows mark axons of peripheral neurons. * Figure 4: MEC-17 controls the levels of microtubule acetylation in mammalian cells. –, Expression of MmMEC-17 in Ptk2 cells increases the levels of acetyl-K40 α-tubulin. Cells expressing either EGFP or EGFP and MmMEC-17 were stained with 6-11B-1 mAb and anti-α-tubulin antibodies. , Depletion of HsMEC-17 in HeLa cells reduces the level of acetyl-K40 α-tubulin. Cells were transfected with either GFP or HsMEC-17 siRNAs and after 50 h, treated for 7 h with either 300 nM trichostatin A (TSA, stock solution in DMSO) or DMSO alone. Cell lysates were analysed by western blot probed with either 6-11B-1 mAb (top panel, shorter exposure in middle panel) or anti-α-tubulin mAb (bottom panel). * Figure 5: MEC-17 has intrinsic, K40-specific α-TAT activity. , Crude Tetrahymena and recombinant MmMEC-17 were used for in vitro acetylation reactions of MEC17-KO axonemes and analysed by western blot using 6-11B-1 and 12G10 mAb. , In vitro acetylation assays were performed with GST-MmMEC-17 using axonemes isolated from either the MEC17-KO (K40) strain or a K40R α-tubulin mutant. The marker (M) contains acetylated glutamate dehydrogenase (55.6 kDa). , Recombinant GST-MmMEC-17 directly acetylates purified tubulin from the MEC17-KO strain in vitro. , Coomassie-blue-stained gel with either purified MEC17-KO tubulin (36 ng) or porcine brain tubulin (15 ng, 99% pure, Cytoskeleton). Author information * Author information * Supplementary information * Comments Primary authors * These authors contributed equally to this work. * Jyothi S. Akella & * Dorota Wloga Affiliations * Department of Cellular Biology, University of Georgia, Athens, Georgia 30602, USA * Jyothi S. Akella, * Dorota Wloga, * Jihyun Kim, * Natalia G. Starostina, * Scott T. Dougan, * Edward T. Kipreos & * Jacek Gaertig * Department of Molecular Biology and Biochemistry, University of California, Irvine, California 92697, USA * Sally Lyons-Abbott & * Naomi S. Morrissette Contributions J.S.A., D.W., J.K., N.G.S., S.L.-A., S.T.D., E.T.K. and J.G. designed and performed the experiments. N.S.M., S.T.D., E.T.K. and J.G. supervised the work in their respective laboratories. J.G. integrated data and wrote drafts of the paper that were edited by all co-authors. Competing financial interests The authors declare no competing financial interests. Corresponding author Correspondence to: * Jacek Gaertig (jgaertig@cb.uga.edu) Supplementary information * Author information * Supplementary information * Comments Movies * Supplementary Movie 1 (4.1M) The movie shows zebrafish embryos injected with 1 ng of random sequence morpholinos and recorded at 48 hpf. * Supplementary Movie 2 (6.9M) The movie shows zebrafish embryos injected with 1 ng of MEC17-ATG morpholinos and recorded at 48 hpf. * Supplementary Movie 3 (6.8M) The movie shows zebrafish embryps injected with 1 ng of MEC17-SP morpholinos and recorded at 48 hpf. PDF files * Supplementary Information (3.4M) The file contains Supplementary Tables 1-2, and Supplementary Figures 1-8, with legends. Additional data - HAATI survivors replace canonical telomeres with blocks of generic heterochromatin
- Nature (London) 467(7312):223 (2010)
Nature | Letter HAATI survivors replace canonical telomeres with blocks of generic heterochromatin * Devanshi Jain1 Search for this author in: * NPG journals * PubMed * Google Scholar * Anna K. Hebden2 Search for this author in: * NPG journals * PubMed * Google Scholar * Toru M. Nakamura3 Search for this author in: * NPG journals * PubMed * Google Scholar * Kyle M. Miller4 Search for this author in: * NPG journals * PubMed * Google Scholar * Julia Promisel Cooper1julie.cooper@cancer.org.uk Search for this author in: * NPG journals * PubMed * Google Scholar * Affiliations * Contributions * Corresponding authorJournal name:NatureVolume: 467 ,Pages:223–227Date published:(09 September 2010)DOI:doi:10.1038/nature09374Received07 September 2009Accepted21 July 2010 Article tools * Full text * 日本語要約 * Print * Email * Download PDF * Download citation * Order reprints * Rights and permissions * Share/bookmark * Connotea * CiteULike * Facebook * Twitter * Delicious * Digg The notion that telomeres are essential for chromosome linearity stems from the existence of two chief dangers: inappropriate DNA damage response (DDR) reactions that mistake natural chromosome ends for double-strand DNA breaks (DSBs), and the progressive loss of DNA from chromosomal termini due to the end replication problem. Telomeres avert the former peril by binding sequence-specific end-protection factors that control the access of DDR activities1, 2. The latter threat is tackled by recruiting telomerase, a reverse transcriptase that uses an integral RNA subunit to template the addition of telomere repeats to chromosome ends3. Here we describe an alternative mode of linear chromosome maintenance in which canonical telomeres are superseded by blocks of heterochromatin. We show that in the absence of telomerase, Schizosaccharomyces pombe cells can survive telomere sequence loss by continually amplifying and rearranging heterochromatic sequences. Because the heterochromati! n assembly machinery is required for this survival mode, we have termed it 'HAATI' (heterochromatin amplification-mediated and telomerase-independent). HAATI uses the canonical end-protection protein Pot1 (ref. 4) and its interacting partner Ccq1 (ref. 5) to preserve chromosome linearity. The data suggest a model in which Ccq1 is recruited by the amplified heterochromatin and provides an anchor for Pot1, which accomplishes its end-protection function in the absence of its cognate DNA-binding sequence. HAATI resembles the chromosome end-maintenance strategy found in Drosophila melanogaster, which lacks specific telomere sequences but nonetheless assembles terminal heterochromatin structures that recruit end-protection factors. These findings reveal a previously unrecognized mode by which cancer cells might escape the requirement for telomerase activation, and offer a tool for studying genomes that sustain unusually high levels of heterochromatinization. View full text Subject terms: * Molecular biology * Genetics * Genomics * Cell biology * Cancer Figures at a glance * Figure 1: Characterization of HAATI strains. , HAATI are DSB resistant compared to circulars. Fivefold serial dilutions of cultures (107 cells ml−1) were grown at 32 °C for 2 days. 'O' denotes circular. MMS, methyl methanesulphonate. , HAATI whole chromosomes fail to enter pulsed-field gels. , NotI digestion releases four terminal fragments, referred to as L, M, I and C, from the ends of Chr I and II; these are replaced by fusion fragments L+I and C+M in circulars. , Terminal, but not internal, fragments of HAATI chromosomes fail to enter gels. Left, ethidium bromide staining of NotI digest PFG. Right, Southern blotting of PFG. , Cleavage at a single I-SceI site on Chr II fails to confer gel entry to HAATI chromosomes (see also Supplementary Fig. 3). All analyses in Fig. 1 were performed on both HAATIrDNA and HAATISTE (see below) with identical results. * Figure 2: Trt1 addition reveals extensive genomic rearrangements in HAATI cells. , Trt1 addition to trt1Δ circulars results in telomere addition and gel entry of Chr III as measured by PFGE and Southern blot analysis. '+T' denotes Trt1 addition. , Trt1 addition to trt1Δ HAATI results in telomere addition and gel entry of all three chromosomes. Cells were analysed as in . , rDNA has spread to all three chromosomes in HAATIrDNA cells, whereas HAATISTE cells contain rDNA only on Chr III (see also Supplementary Fig. 5). Cells were analysed as in . , NotI-digested HAATISTE chromosomes have amplified STE sequences. Analysis with ('+T') and without Trt1 addition. * Figure 3: HAATI survival requires Clr4 and Rhp51. , Clr4 is important for HAATI formation. NotI digests of chromosomes of 12 trt1Δclr4Δ progeny derived from heterozygous clr4Δ/clr4+ trt1Δ/trt1+ diploids were grown in competitive conditions (see legend to Supplementary Table 1). Only 2/12 progeny (asterisks) gave HAATI-type hybridization patterns. , Clr4 is important for HAATI maintenance. clr4+ was deleted in HAATIrDNA, circular and linear trt1Δ strains. Clr4 is required for HAATI maintenance. To definitively assess a role for Clr4 in linear survival, 20 clr4Δ linear transformants were analysed (two are shown). None were affected by clr4+ deletion. , HAATI survival requires Rhp51. rhp51Δ/rhp51+ trt1Δ/trt1+ diploids were treated as in . 'Lin' denotes linear trt1Δ. , Schematic of NotI fragments resulting from di-chromosome circle formation. * Figure 4: HAATI strains lack terminal telomere sequences but require Pot1 for end-protection. , HAATISTE cells lack telomere sequences whereas HAATIrDNA cells contain very short internal stretches of telomere-like sequence. Genomic DNA digested with restriction enzyme cocktail (see Methods) was subjected to Southern blotting. , Telomere sequences in HAATIrDNA cells are at internal genomic locations. Genomic DNA was treated with BAL-31 for 0, 15, 30 and 60 min and subsequently treated as in . , Analysis of NotI digests shows HAATI chromosome maintenance requires Pot1 and Ccq1, but not Taz1. A ccq1-deleted trt1+ strain is included for comparison. Author information * Author information * Supplementary information * Comments Affiliations * Cancer Research UK, London Research Institute, 44 Lincoln's Inn Fields, London WC2A 3PX, UK * Devanshi Jain & * Julia Promisel Cooper * Imperial College London Ovarian Cancer Action Group, London W12 0NN, UK * Anna K. Hebden * Department of Biochemistry and Molecular Genetics, University of Illinois, Chicago, Illinois 60607, USA * Toru M. Nakamura * Gurdon Institute, Cambridge CB2 1QN, UK * Kyle M. Miller Contributions D.J. performed the experiments in Figs 3 and 4, Supplementary Figs 6 and 9–17 and Supplementary Tables 1 and 2, and reproduced Figs 1a, b, 2a, d and Supplementary Figs 2 and 8a. A.K.H. first isolated HAATI survivors and performed the experiments in Figs 1 and 2b–d, and Supplementary Figs 2, 4, 5 and 8. T.M.N. performed the experiments in Fig. 2a. K.M.M. first showed that circular strains are hypersensitive to DSB-inducing agents. J.P.C. designed and supervised the study. J.P.C. and D.J. generated the figures and wrote the paper. Competing financial interests The authors declare no competing financial interests. Corresponding author Correspondence to: * Julia Promisel Cooper (julie.cooper@cancer.org.uk) Supplementary information * Author information * Supplementary information * Comments PDF files * Supplementary Information (913K) The file contains Supplementary Figures 1-17 with legends, Supplementary Tables 1-2 and a Strain Table. Additional data - Telomeres avoid end detection by severing the checkpoint signal transduction pathway
- Nature (London) 467(7312):228 (2010)
Nature | Letter Telomeres avoid end detection by severing the checkpoint signal transduction pathway * Tiago Carneiro1 Search for this author in: * NPG journals * PubMed * Google Scholar * Lyne Khair2 Search for this author in: * NPG journals * PubMed * Google Scholar * Clara C. Reis1 Search for this author in: * NPG journals * PubMed * Google Scholar * Vanessa Borges1 Search for this author in: * NPG journals * PubMed * Google Scholar * Bettina A. Moser2 Search for this author in: * NPG journals * PubMed * Google Scholar * Toru M. Nakamura2 Search for this author in: * NPG journals * PubMed * Google Scholar * Miguel Godinho Ferreira1mgferreira@igc.gulbenkian.pt Search for this author in: * NPG journals * PubMed * Google Scholar * Affiliations * Contributions * Corresponding authorJournal name:NatureVolume: 467 ,Pages:228–232Date published:(09 September 2010)DOI:doi:10.1038/nature09353Received12 August 2009Accepted14 July 2010 Article tools * Full text * 日本語要約 * Print * Email * Download PDF * Download citation * Order reprints * Rights and permissions * Share/bookmark * Connotea * CiteULike * Facebook * Twitter * Delicious * Digg Telomeres protect the normal ends of chromosomes from being recognized as deleterious DNA double-strand breaks. Recent studies have uncovered an apparent paradox: although DNA repair is prevented, several proteins involved in DNA damage processing and checkpoint responses are recruited to telomeres in every cell cycle and are required for end protection1. It is currently not understood how telomeres prevent DNA damage responses from causing permanent cell cycle arrest. Here we show that fission yeast (Schizosaccharomyces pombe) cells lacking Taz1, an orthologue of human TRF1 and TRF2 (ref. 2), recruit DNA repair proteins (Rad22RAD52 and Rhp51RAD51, where the superscript indicates the human orthologue) and checkpoint sensors (RPA, Rad9, Rad26ATRIP and Cut5/Rad4TOPBP1) to telomeres. Despite this, telomeres fail to accumulate the checkpoint mediator Crb253BP1 and, consequently, do not activate Chk1-dependent cell cycle arrest. Artificially recruiting Crb253BP1 to taz1Δ telomer! es results in a full checkpoint response and cell cycle arrest. Stable association of Crb253BP1 to DNA double-strand breaks requires two independent histone modifications: H4 dimethylation at lysine 20 (H4K20me2) and H2A carboxy-terminal phosphorylation (γH2A)3, 4, 5. Whereas γH2A can be readily detected, telomeres lack H4K20me2, in contrast to internal chromosome locations. Blocking checkpoint signal transduction at telomeres requires Pot1 and Ccq1, and loss of either Pot1 or Ccq1 from telomeres leads to Crb253BP1 foci formation, Chk1 activation and cell cycle arrest. Thus, telomeres constitute a chromatin-privileged region of the chromosomes that lack essential epigenetic markers for DNA damage response amplification and cell cycle arrest. Because the protein kinases ATM and ATR must associate with telomeres in each S phase to recruit telomerase6, exclusion of Crb253BP1 has a critical role in preventing telomeres from triggering cell cycle arrest. View full text Subject terms: * Molecular biology * Cancer Figures at a glance * Figure 1: taz1Δ telomeres undergo the DNA damage response without eliciting a checkpoint-dependent cell cycle arrest. , Live analysis of Rad22RAD52–GFP and its co-localization with Pot1–mRFP used as a telomeric marker. WT, wild type. Bleo, bleomycin. , Dot-blot ChIP quantification of Rhp51RAD51 bound to telomeres for the indicated strains. rhp51Δ cells were used as a control. n ≥ 3; ** P < 0.01 based on a two-tailed Student's t-test to control sample. Error bars represent mean ± standard deviation (s.d.). , Strategy to generate taz1Δ mutants de novo., Histograms depict the distribution of cell sizes (μm) after germination over the course of the experiment. , Immunoblot analysis of Chk1–Myc in wild-type and taz1Δ cells. The asterisk depicts an antibody cross-reactive band used as a loading control. The DNA damaging agent bleomycin (Bleo; 5 mU ml−1) was added to cultures as a positive control. P indicates hyperphosphorylation. * Figure 2: taz1Δ telomeres initiate a DNA damage checkpoint response. , Checkpoint pathways in fission yeast. DNA-damage checkpoint (left) and replication checkpoint (shaded on the right). , Co-localization of Rad11RPA–GFP, Rad26ATRIP–GFP, Rad9–YFP, Cut5TOPBP1–GFP with Pot1–mRFP (used as a telomere marker) (left) and quantification of cells showing telomeric and non-telomeric foci (right). , Telomeric dot-blot ChIP quantification of Rad11RPA–Flag and Cut5TOPBP1–Myc. Untagged strains were used as controls. n ≥ 3; ** P < 0.01 and *** P < 0.001 based on a two-tailed Student's t-test to control sample. Error bars represent mean ± s.d. , Immunoblot analysis of Rad9–HA and Rad26ATRIP–HA. Bleomycin (5 mU ml−1) was added to cultures as a positive control. , Immunoblot analysis of Rad26ATRIP–HA and Chk1–Myc in wild-type cells treated with increasing concentrations of bleomycin. Asterisks point to a cross-reactive band that serves as a loading control. P indicates hyperphosphorylation. * Figure 3: Dysfunctional taz1Δ telomeres avert cell cycle arrest by preventing recruitment of Crb253BP1. , Visualization and quantification of YFP–Crb2 foci in the indicated strains. , Immunoblot analysis of YFP–Crb2. Bleomycin (5 mU ml−1) was added to cultures where indicated (+). , Telomeric dot-blot ChIP quantification for Crb253BP1–TAP, γH2A, H4K20me1, H4K20me2 and H4K20me3. Positive controls: quantitative polymerase chain reaction (qPCR) ChIP was performed for TAP–Crb253BP1 using primers adjacent to an internal double-strand break generated by HO cleavage (HO site) and to wild-type telomeres (Telo) and for H4K20me2 using primers for the ade6+ locus (Internal). For negative controls we used H2A phosphorylation mutants hta1-S129A hta2-S128A (hta1 hta2) for γH2A and set9Δ for all forms of H4K20 methylation. n ≥ 3; * P < 0.05, ** P < 0.01 and *** P < 0.001 based on a two-tailed Student's t-test to controls. Error bars represent mean ± s.d. , Localization of MybTaz1–YFP–Crb2 expressed from a low expression vector (pREP81). , Distributio! n of sizes (µm) in cells carrying either MybTaz1–YFP–Crb2 or an empty plasmid control. , Immunoblot analysis of Chk1–Myc. P indicates hyperphosphorylation. Asterisk indicates a cross-reactive band that serves as a loading control. * Figure 4: Pot1 and Ccq1 prevent Crb253BP1-dependent checkpoints at telomeres. , Distribution of cell sizes over time (µm) after germination of spores with the indicated genotype. , Immunoblot analysis of Chk1–Myc. Extracts derived from diploid cells are indicated with a dash. P indicates hyperphosphorylation. Asterisks indicate a cross-reactive band used as a loading control. , Telomere-length analysis by Southern blotting using a telomere probe. , Distribution of cell sizes (µm) in the absence of either Ccq1 or Trt1 in wild-type and taz1Δ cells. , Immunoblot analysis of Chk1–Myc. , Visualization and quantification of plasmid borne YFP–Crb253BP1 foci. , Model for checkpoint inhibition at fission yeast telomeres. Pot1 and Ccq1, together with the Taz1 complex, define a chromatin-privileged region that excludes H4K20me2 and prevents stable Cbr253BP1 association. As a result, the full checkpoint response is severed at telomeres and cell cycle arrest is averted. Author information * Author information * Supplementary information * Comments Affiliations * Instituto Gulbenkian de Ciência, Oeiras 2781-901, Portugal * Tiago Carneiro, * Clara C. Reis, * Vanessa Borges & * Miguel Godinho Ferreira * Department of Biochemistry and Molecular Genetics, University of Illinois, Chicago, Illinois 60607, USA * Lyne Khair, * Bettina A. Moser & * Toru M. Nakamura Contributions T.C. helped with the design and executed most experiments. L.K. performed ChIP experiments. C.C.R. performed western and Southern blotting experiments. V.B. performed live cell analysis. B.A.M. established the ChIP and HO assays. T.M.N. contributed to the design of the ChIP and HO assays. All authors contributed with strains and data analysis. M.G.F. conceived the study, performed live cell analysis and wrote the paper. Competing financial interests The authors declare no competing financial interests. Corresponding author Correspondence to: * Miguel Godinho Ferreira (mgferreira@igc.gulbenkian.pt) Supplementary information * Author information * Supplementary information * Comments PDF files * Supplementary Information (924K) This file contains Supplementary Figures 1-6 with legends and Supplementary Tables 1-2. Additional data - Structural basis of Na+-independent and cooperative substrate/product antiport in CaiT
- Nature (London) 467(7312):233 (2010)
Nature | Letter Structural basis of Na+-independent and cooperative substrate/product antiport in CaiT * Sabrina Schulze1 Search for this author in: * NPG journals * PubMed * Google Scholar * Stefan Köster1 Search for this author in: * NPG journals * PubMed * Google Scholar * Ulrike Geldmacher1 Search for this author in: * NPG journals * PubMed * Google Scholar * Anke C. Terwisscha van Scheltinga1, 2 Search for this author in: * NPG journals * PubMed * Google Scholar * Werner Kühlbrandt1werner.kuehlbrandt@biophys.mpg.de Search for this author in: * NPG journals * PubMed * Google Scholar * Affiliations * Contributions * Corresponding authorJournal name:NatureVolume: 467 ,Pages:233–236Date published:(09 September 2010)DOI:doi:10.1038/nature09310Received08 October 2009Accepted24 June 2010 Article tools * Full text * 日本語要約 * Print * Email * Download PDF * Download citation * Order reprints * Rights and permissions * Share/bookmark * Connotea * CiteULike * Facebook * Twitter * Delicious * Digg Transport of solutes across biological membranes is performed by specialized secondary transport proteins in the lipid bilayer1, and is essential for life. Here we report the structures of the sodium-independent carnitine/butyrobetaine antiporter CaiT from Proteus mirabilis (PmCaiT) at 2.3-Å and from Escherichia coli (EcCaiT) at 3.5-Å resolution. CaiT belongs to the family of betaine/carnitine/choline transporters (BCCT), which are mostly Na+ or H+ dependent, whereas EcCaiT is Na+ and H+ independent2. The three-dimensional architecture of CaiT resembles that of the Na+-dependent transporters LeuT3 and BetP4, but in CaiT a methionine sulphur takes the place of the Na+ ion to coordinate the substrate in the central transport site, accounting for Na+-independent transport. Both CaiT structures show the fully open, inward-facing conformation, and thus complete the set of functional states that describe the alternating access mechanism5. EcCaiT contains two bound butyrobetaine ! substrate molecules, one in the central transport site, the other in an extracellular binding pocket. In the structure of PmCaiT, a tryptophan side chain occupies the transport site, and access to the extracellular site is blocked. Binding of both substrates to CaiT reconstituted into proteoliposomes is cooperative, with Hill coefficients up to 1.7, indicating that the extracellular site is regulatory. We propose a mechanism whereby the occupied regulatory site increases the binding affinity of the transport site and initiates substrate translocation. View full text Subject terms: * Structural biology * Molecular biology * Biochemistry * Biophysics Figures at a glance * Figure 1: CaiT structure and bound substrates. , A cut though the protomer shows the open cytoplasmic funnel, and the two bound γ-butyrobetaine molecules (arrows). , The tryptophan box of the central transport site binds the substrate to be translocated. The Met 331 sulphur coordinates the substrate (blue; 2Fo−Fc map at 1.0σ) by polar interaction with the carboxyl group (dotted) in EcCaiT, instead of Na1 in the Na+-dependent transporters4, 6. , In PmCaiT, the Trp 323 indole group (circled) is rotated by 43° each in χ1 and χ2, preventing substrate binding. In the extracellular second binding site of EcCaiT (), a bound γ-butyrobetaine (contoured as above) is coordinated by cation–π interaction with Tyr 114 and Trp 316, plus an H bond of the γ-butyrobetaine carboxyl to the Gly 315 backbone nitrogen. In the substrate-free second binding site of PmCaiT (), two water molecules connect TM8 and TM12. A third water molecule links TM3 to the indole nitrogen of Trp 316, and forms a hydrogen bond to Arg −! 2 (grey) between the N terminus and His6 tag of a symmetry-related protomer, blocking the second site. * Figure 2: Hydrogen bond networks in PmCaiT. , Hydrogen bonds (dotted) around Glu 111, connecting TM3 and TM4 to TM8. These helices must move apart to release the substrate in the outside-open conformation. , Arg 262, which replaces Na2 in the Na+-dependent transporters, is located between TM3 and TM10, stabilizing the unwound stretch of TM3 in the membrane by hydrogen bonds. * Figure 3: Substrate transport and binding in CaiT. , Substrate uptake in wild-type EcCaiT (pink), wild-type PmCaiT (black) and PmCaiT mutants M331V (blue), W316A (green) and E111A (red) reconstituted into proteoliposomes in sodium-free buffer (left) or with 100 mM NaCl. , Binding of γ-butyrobetaine or l-carnitine to PmCaiT reconstituted into proteoliposomes in sodium-free buffer. Error bars, s.e.m. of triplicate experiments. * Figure 4: Proposed mechanism of cooperative transport. The empty transporter, represented by the PmCaiT structure, is activated by l-carnitine (yellow diamond) binding to the regulatory site. This triggers the re-orientation of Trp 323 (blue disk), and γ-butyrobetaine (red diamond) binds to the central transport site from the cytoplasm. The state in which both binding sites are occupied is represented by the EcCaiT structure. In the occluded state, represented by the BetP structure4, the substrate in the transport site is inaccessible. In the outside-open state, represented by the LeuT structure6, γ-butyrobetaine in the central transport site is replaced by l-carnitine. CaiT then changes conformation through the occluded state back to the inside-open state, releasing l-carnitine to the cytoplasm, where it is metabolized. The next γ-butyrobetaine product binds, and the transport cycle repeats. When the outside l-carnitine concentration drops below a critical level, the substrate diffuses out of the regulatory site, and the t! ransporter switches off. Author information * Author information * Supplementary information * Comments Affiliations * Department of Structural Biology, Max Planck Institute of Biophysics, Max-von-Laue Strasse 3, 60438 Frankfurt am Main, Germany * Sabrina Schulze, * Stefan Köster, * Ulrike Geldmacher, * Anke C. Terwisscha van Scheltinga & * Werner Kühlbrandt * Present address: Laboratory of Biophysical Chemistry, Nijenborgh 4, 9747 AG Groningen, The Netherlands. * Anke C. Terwisscha van Scheltinga Contributions Experiments were performed by S.S. and U.G.; cloning and mutagenesis was performed by S.K. Crystals were grown by S.S., diffraction data were collected and processed by S.S. and A.C.T.v.S., and the structures were analysed by S.S., A.C.T.v.S. and W.K. S.S. and W.K. wrote the manuscript. Competing financial interests The authors declare no competing financial interests. Corresponding author Correspondence to: * Werner Kühlbrandt (werner.kuehlbrandt@biophys.mpg.de) Coordinates and structure factors for P. mirabilis CaiT and E. coli CaiT with bound substrate are deposited in the Protein Data Bank under accession numbers 2WSW and 2WSX, respectively.. Supplementary information * Author information * Supplementary information * Comments PDF files * Supplementary Information (21.9M) This file contains Supplementary Background Notes, Supplementary Tables 1- 4, Supplementary Figures 1- 9 with legends and additional references. Additional data - Dark they were, and strange inside
- Nature (London) 467(7312):244 (2010)
Nature | Futures Dark they were, and strange inside * Vaughan Stanger1 Search for this author in: * NPG journals * PubMed * Google ScholarJournal name:NatureVolume: 467 ,Page:244Date published:(09 September 2010)DOI:doi:10.1038/467244aPublished online08 September 2010 A very blind date. Article tools * Print * Email * Download PDF * Download citation * Order reprints * Rights and permissions * Share/bookmark * Connotea * CiteULike * Facebook * Twitter * Delicious * Digg If it weren't for the boffins who resurrected the Large Hadron Collider I wouldn't be placing flowers on my best friend's grave. For once, Marcie followed my advice. I wish she hadn't. Marcie's journey to the hereafter began when she leaned across my kitchen table and fixed me with the kind of look she usually reserves for guys with performance issues. "You did what?" "I signed up for Internet dating!" "Why'd you do that, Jen?" "Cos I'm thirty-five." Marcie rolled her eyes. "You're just having a cold spell. Everyone gets those." JACEY Excepting Marcie, of course. She's never had to go shopping to get men. Big boobs and Beyoncé hair do the job for her, whereas I rate as 'presentable' in a good light. Admittedly, I did select Attractive on the web-form, but then who wouldn't? "Okay," Marcie said with a sigh. "Let's take a look." I fired up my laptop. Marcie chuckled her way through the website's blurb. "'Fundamentals.com: your portal to a multiverse of love.' Yeah, right!" I scrolled through my profile, highlighting those difficult-to-write personal bits. Marcie waved me onwards. "Never mind that drivel. What about your ideal man?" I showed her. "I see you've selected Dark." "So?" "I'm just saying." Her expression suggested she remembered my adventures with Ahmed. "I did also select Attractive and Solvent." "Which will get you Tubby and Tightwad." Marcie shook her head before giving me a wink. "Go for it girl!" "So, you gonna tell me what happened?" I could tell Marcie was excited because she didn't make her usual crack about Botox even though I was frowning. "Well, I turned up at All Bar One wearing my —" "I know what you were wearing!" I blushed but said nothing. "What did he look like?" "It's hard to say." Marcie groaned. "You did pick one with a photo, right?" I shook my head. "No, but ..." "Have I taught you nothing?" Quite the opposite in fact, but I wasn't about to say so. I sighed and continued my account. "There were lots of men there, but no standalones. So I sat at a corner table and waited. After half an hour of cooling my heels, I was about to go when ... the best way I can put it is that I felt a presence. I couldn't see him properly or work out what he was saying; yet I knew someone was sat next to me. But take it from me, you feel a right fool talking to thin air, so pretty soon I made my excuses and left." "Good call." "But walking to the bus-stop, I could feel someone holding my hand. And when I finally got into bed, well ..." "Omigod, you pulled!" Marcie high-fived me before asking the inevitable question: "So, was he any good?" "Well, I did enjoy a very nice buzz." I could tell Marcie wasn't convinced by the way she frowned at me. And who could blame her? But I knew I'd been to bed with a man, even if I hadn't actually clapped eyes on him at any stage. I sipped my Chardonnay in silence while I awaited Marcie's verdict. Finally she delivered it. "I bet he wasn't even dark, never mind tall and handsome." On that point she couldn't have been more wrong. The official news about our exotic friends broke the next day. According to the hot-looking guy on Sky News, the Large Haddock Colander (the pride of CERN, as rechristened by Marcie) hadn't opened up a planet-swallowing black hole as some had predicted, but it had definitely opened up a gateway to something. Within days, an MIT boffin announced that he'd built a dark matter delineator. Once the portable model hit the stores, my dates got a lot easier to spot. Fortunately I've always preferred the silent type. I was dating my fourth dark guy by the time Marcie decided to join in the fun. My best friend asking me for dating advice; now that was a first! "Okay, let's build your profile," I said. "And no, you can't upload those photos of you wearing nothing." Marcie waggled her tongue at me before clicking her way through the options so expertly I wondered whether she was quite as inexperienced at this kind of thing as she claimed. "I see you didn't select Dark," I said. Marcie grinned like a snake hypnotizing a mouse. "I'm looking for something a lot stronger than a 'very nice buzz'!" After three days with no phone calls or messages, I felt sick with worry. I texted Marcie a lurid description of my latest date, but didn't receive a reply. Either she was having such a good time it had left her speechless — another first — or her alley-cat morals had finally landed her in trouble. As I drove into Marcie's street a fleet of fire engines and ambulances wailed past. Some hundred metres from her home, a police-boy with a volcanic complexion waved me back. He needn't have bothered. One glance at the huge pile of smoking rubble where Marcie's apartment block had once stood was enough. Last I heard the death toll had topped 50. Needless to say, Fundamentals.com has withdrawn its Energetic option. It seems that some guys really are too dangerous to date, especially those made of antimatter. According to the boffins, the containment field needs more work. Once the dust has settled I'll resume dating. Marcie would want me to. I miss her terribly but remember her well. Say what you like about my best friend, but she definitely went out with a bang. Author information * Author information * Comments Affiliations * Vaughan Stanger wishes to make it clear that any visits he might have made to dating websites were purely in the interests of researching this story. Additional data
0 comments:
Post a Comment